RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1217896822:

Variant ID: vg1217896822 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17896822
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGTTCACACTAAAATTAAAAGTTTGGTTGAAATTGGAACGATGTGACGAAAAAGTTGGAAGATTGTGTGTAAGAAAGTTTTGATGTGATGAAAAAGTT[G/A,T]
GAAGTTTGAATAATTATTTTGAAACTAAACACGGCCCTATATATGGTGTCCTTTTTTCTAGACTATCTATTTATGTTGAATTCTTAACCATAAGTCCATT

Reverse complement sequence

AATGGACTTATGGTTAAGAATTCAACATAAATAGATAGTCTAGAAAAAAGGACACCATATATAGGGCCGTGTTTAGTTTCAAAATAATTATTCAAACTTC[C/T,A]
AACTTTTTCATCACATCAAAACTTTCTTACACACAATCTTCCAACTTTTTCGTCACATCGTTCCAATTTCAACCAAACTTTTAATTTTAGTGTGAACTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.00%	45.30%	0.42%	0.00%	T: 0.34%
All Indica	2759	43.50%	55.40%	0.47%	0.00%	T: 0.58%
All Japonica	1512	72.10%	27.70%	0.20%	0.00%	NA
Aus	269	48.30%	51.70%	0.00%	0.00%	NA
Indica I	595	49.20%	50.30%	0.50%	0.00%	NA
Indica II	465	30.50%	68.40%	1.08%	0.00%	NA
Indica III	913	40.40%	57.80%	0.11%	0.00%	T: 1.64%
Indica Intermediate	786	50.50%	48.90%	0.51%	0.00%	T: 0.13%
Temperate Japonica	767	96.10%	3.70%	0.26%	0.00%	NA
Tropical Japonica	504	42.90%	57.10%	0.00%	0.00%	NA
Japonica Intermediate	241	56.80%	42.70%	0.41%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	30.00%	4.44%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217896822	G -> A	LOC_Os12g29950.1	upstream_gene_variant ; 4108.0bp to feature; MODIFIER	silent_mutation	Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1217896822	G -> A	LOC_Os12g29950.2	upstream_gene_variant ; 4108.0bp to feature; MODIFIER	silent_mutation	Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1217896822	G -> A	LOC_Os12g29940.1	downstream_gene_variant ; 2265.0bp to feature; MODIFIER	silent_mutation	Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1217896822	G -> A	LOC_Os12g29940-LOC_Os12g29950	intergenic_region ; MODIFIER	silent_mutation	Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1217896822	G -> T	LOC_Os12g29950.1	upstream_gene_variant ; 4108.0bp to feature; MODIFIER	silent_mutation	Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1217896822	G -> T	LOC_Os12g29950.2	upstream_gene_variant ; 4108.0bp to feature; MODIFIER	silent_mutation	Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1217896822	G -> T	LOC_Os12g29940.1	downstream_gene_variant ; 2265.0bp to feature; MODIFIER	silent_mutation	Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1217896822	G -> T	LOC_Os12g29940-LOC_Os12g29950	intergenic_region ; MODIFIER	silent_mutation	Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N

Showing 1 to 8 of 8 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217896822	NA	2.14E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	NA	8.90E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	NA	5.33E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	8.20E-06	8.22E-06	mr1214	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	NA	1.74E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	NA	2.17E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	1.73E-06	6.12E-06	mr1230	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	NA	6.25E-06	mr1327	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	5.62E-06	NA	mr1330	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822	NA	1.75E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 32 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1217896822:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact