Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217808832:

Variant ID: vg1217808832 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17808832
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

GTTAAGCTTAAGGGTAGAGTGACACACATCTAAAGATTTAGGTAACTCCTACATTCTCCTAATTATAGCTAAGTGGTAGTAGTTTAGGTATGTTCCATTC[C/T]
TGTACTTCTAGTATACAACATCTTAGTATATTCTAACTAGTATACACTATGTAGTATAACCCCTTTAACAATGCAGCATAGCTAAGCCTAAGCATAGCTA

Reverse complement sequence

TAGCTATGCTTAGGCTTAGCTATGCTGCATTGTTAAAGGGGTTATACTACATAGTGTATACTAGTTAGAATATACTAAGATGTTGTATACTAGAAGTACA[G/A]
GAATGGAACATACCTAAACTACTACCACTTAGCTATAATTAGGAGAATGTAGGAGTTACCTAAATCTTTAGATGTGTGTCACTCTACCCTTAAGCTTAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.80%	6.50%	8.87%	4.85%	NA
All Indica	2759	86.80%	10.80%	1.59%	0.80%	NA
All Japonica	1512	72.20%	0.20%	14.68%	12.96%	NA
Aus	269	55.80%	0.70%	40.52%	2.97%	NA
Indica I	595	88.20%	7.20%	2.69%	1.85%	NA
Indica II	465	95.10%	3.90%	0.65%	0.43%	NA
Indica III	913	87.50%	11.30%	1.20%	0.00%	NA
Indica Intermediate	786	80.20%	16.90%	1.78%	1.15%	NA
Temperate Japonica	767	96.50%	0.10%	1.17%	2.22%	NA
Tropical Japonica	504	44.60%	0.00%	30.75%	24.60%	NA
Japonica Intermediate	241	52.30%	0.80%	24.07%	22.82%	NA
VI/Aromatic	96	62.50%	1.00%	34.38%	2.08%	NA
Intermediate	90	81.10%	5.60%	12.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217808832	C -> DEL	N	N	silent_mutation	Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg1217808832	C -> T	LOC_Os12g29790.1	upstream_gene_variant ; 3015.0bp to feature; MODIFIER	silent_mutation	Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg1217808832	C -> T	LOC_Os12g29800.1	downstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg1217808832	C -> T	LOC_Os12g29790-LOC_Os12g29800	intergenic_region ; MODIFIER	silent_mutation	Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217808832	7.07E-06	7.07E-06	mr1321	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	6.89E-07	6.89E-07	mr1323	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	8.24E-06	1.18E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	NA	6.21E-07	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	NA	1.95E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	NA	3.84E-06	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	5.78E-06	5.78E-06	mr1338	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	9.66E-06	3.95E-06	mr1346	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	NA	6.72E-06	mr1532	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	7.41E-07	7.41E-07	mr1540	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	4.30E-06	NA	mr1719	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832	2.75E-07	8.50E-09	mr1732	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251