Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217795967:

Variant ID: vg1217795967 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17795967
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTAAAAATTCTCCATGATTAGTTACGCTCTTTGAAATTATATTGGAATTTTTAGAGCTTAATTGCTAATTTTATTAATATAGACATCATTTAACAA[C/T]
TATTTAATTGGAAAAAGAAAGAAAATACTTCCATTTAGGTTTGCTTCCAAATAAACACATTCAATTACTTATATATGTAAATCTTCTGAAAAAATGAGCA

Reverse complement sequence

TGCTCATTTTTTCAGAAGATTTACATATATAAGTAATTGAATGTGTTTATTTGGAAGCAAACCTAAATGGAAGTATTTTCTTTCTTTTTCCAATTAAATA[G/A]
TTGTTAAATGATGTCTATATTAATAAAATTAGCAATTAAGCTCTAAAAATTCCAATATAATTTCAAAGAGCGTAACTAATCATGGAGAATTTTTAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.80%	30.70%	0.19%	33.28%	NA
All Indica	2759	31.70%	34.70%	0.25%	33.42%	NA
All Japonica	1512	47.30%	22.00%	0.00%	30.69%	NA
Aus	269	20.40%	41.30%	0.37%	37.92%	NA
Indica I	595	45.90%	52.10%	0.00%	2.02%	NA
Indica II	465	21.70%	17.40%	0.43%	60.43%	NA
Indica III	913	23.30%	34.00%	0.11%	42.61%	NA
Indica Intermediate	786	36.50%	32.40%	0.51%	30.53%	NA
Temperate Japonica	767	80.80%	15.40%	0.00%	3.78%	NA
Tropical Japonica	504	4.60%	34.70%	0.00%	60.71%	NA
Japonica Intermediate	241	29.90%	16.60%	0.00%	53.53%	NA
VI/Aromatic	96	5.20%	32.30%	1.04%	61.46%	NA
Intermediate	90	46.70%	24.40%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217795967	C -> DEL	N	N	silent_mutation	Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669	N	N	N	N
vg1217795967	C -> T	LOC_Os12g29760.1	upstream_gene_variant ; 4856.0bp to feature; MODIFIER	silent_mutation	Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669	N	N	N	N
vg1217795967	C -> T	LOC_Os12g29760.2	upstream_gene_variant ; 4856.0bp to feature; MODIFIER	silent_mutation	Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669	N	N	N	N
vg1217795967	C -> T	LOC_Os12g29760-LOC_Os12g29780	intergenic_region ; MODIFIER	silent_mutation	Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217795967	NA	3.35E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967	NA	8.62E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967	NA	9.56E-06	mr1579	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967	NA	4.21E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967	4.75E-06	8.87E-07	mr1355_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967	3.31E-07	5.88E-08	mr1360_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967	4.80E-06	6.96E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251