Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217794325:

Variant ID: vg1217794325 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17794325
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.52, A: 0.49, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TACTTAACATCTTTTCACTTGATATAATTTGAAATTGATATATATCATTTCCCGTTGCAGCGTACAGGCACCCAACTAGTTAGAGTATATTTAATTACTT[A/G]
CAGTACCTATATAGAGAAATTTCATAATCCTTGAAAAAGTACTTCGAGGTACGTTGAGAAACTTACTTAGTACATTGAGGTACTCAAGGATAGTAAAACT

Reverse complement sequence

AGTTTTACTATCCTTGAGTACCTCAATGTACTAAGTAAGTTTCTCAACGTACCTCGAAGTACTTTTTCAAGGATTATGAAATTTCTCTATATAGGTACTG[T/C]
AAGTAATTAAATATACTCTAACTAGTTGGGTGCCTGTACGCTGCAACGGGAAATGATATATATCAATTTCAAATTATATCAAGTGAAAAGATGTTAAGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.10%	30.60%	0.61%	32.67%	NA
All Indica	2759	32.10%	34.50%	0.69%	32.69%	NA
All Japonica	1512	47.40%	22.10%	0.26%	30.29%	NA
Aus	269	20.40%	41.30%	1.49%	36.80%	NA
Indica I	595	46.10%	51.90%	0.00%	2.02%	NA
Indica II	465	21.90%	17.20%	1.94%	58.92%	NA
Indica III	913	23.70%	33.80%	0.44%	42.06%	NA
Indica Intermediate	786	37.50%	32.20%	0.76%	29.52%	NA
Temperate Japonica	767	80.70%	15.50%	0.13%	3.65%	NA
Tropical Japonica	504	5.00%	34.70%	0.40%	59.92%	NA
Japonica Intermediate	241	29.90%	16.60%	0.41%	53.11%	NA
VI/Aromatic	96	5.20%	32.30%	1.04%	61.46%	NA
Intermediate	90	46.70%	23.30%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217794325	A -> DEL	N	N	silent_mutation	Average:18.86; most accessible tissue: Callus, score: 71.64	N	N	N	N
vg1217794325	A -> G	LOC_Os12g29760.1	upstream_gene_variant ; 3214.0bp to feature; MODIFIER	silent_mutation	Average:18.86; most accessible tissue: Callus, score: 71.64	N	N	N	N
vg1217794325	A -> G	LOC_Os12g29760.2	upstream_gene_variant ; 3214.0bp to feature; MODIFIER	silent_mutation	Average:18.86; most accessible tissue: Callus, score: 71.64	N	N	N	N
vg1217794325	A -> G	LOC_Os12g29760-LOC_Os12g29780	intergenic_region ; MODIFIER	silent_mutation	Average:18.86; most accessible tissue: Callus, score: 71.64	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217794325	NA	8.49E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217794325	NA	6.60E-07	mr1579	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217794325	NA	1.54E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217794325	1.55E-06	2.70E-07	mr1355_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217794325	7.85E-06	1.49E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217794325	NA	5.98E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217794325	NA	5.65E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251