| Variant ID: vg1217551907 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17551907 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAACGAATATCAAGAGAACTCTTACAAAGACAAGGGTGTTATAAGGGAGTTTAAGACCCTCTTTTTTTTCTAGATTCCATAGTTGGATTTTTGTTTGCA[C/T]
GCTTTCCAAGTTTTTAAATGGTGTCTTTTTTAAACCACATTTTAACTTTTTAGAAGTCAATTTATTTGTTTATACCCTCAAATAGCTACAACATAAATCA
TGATTTATGTTGTAGCTATTTGAGGGTATAAACAAATAAATTGACTTCTAAAAAGTTAAAATGTGGTTTAAAAAAGACACCATTTAAAAACTTGGAAAGC[G/A]
TGCAAACAAAAATCCAACTATGGAATCTAGAAAAAAAAGAGGGTCTTAAACTCCCTTATAACACCCTTGTCTTTGTAAGAGTTCTCTTGATATTCGTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 2.40% | 0.36% | 14.73% | NA |
| All Indica | 2759 | 97.70% | 0.90% | 0.18% | 1.23% | NA |
| All Japonica | 1512 | 54.40% | 5.70% | 0.60% | 39.29% | NA |
| Aus | 269 | 94.10% | 0.00% | 0.37% | 5.58% | NA |
| Indica I | 595 | 98.50% | 0.00% | 0.34% | 1.18% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.00% | 0.65% | NA |
| Indica III | 913 | 97.70% | 1.40% | 0.22% | 0.66% | NA |
| Indica Intermediate | 786 | 96.20% | 1.40% | 0.13% | 2.29% | NA |
| Temperate Japonica | 767 | 78.10% | 1.40% | 0.65% | 19.82% | NA |
| Tropical Japonica | 504 | 26.60% | 4.00% | 0.79% | 68.65% | NA |
| Japonica Intermediate | 241 | 37.30% | 22.80% | 0.00% | 39.83% | NA |
| VI/Aromatic | 96 | 57.30% | 0.00% | 1.04% | 41.67% | NA |
| Intermediate | 90 | 82.20% | 2.20% | 1.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217551907 | C -> DEL | N | N | silent_mutation | Average:17.201; most accessible tissue: Zhenshan97 young leaf, score: 22.751 | N | N | N | N |
| vg1217551907 | C -> T | LOC_Os12g29510-LOC_Os12g29520 | intergenic_region ; MODIFIER | silent_mutation | Average:17.201; most accessible tissue: Zhenshan97 young leaf, score: 22.751 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217551907 | 3.22E-07 | 3.22E-07 | mr1061 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551907 | 4.60E-06 | 4.60E-06 | mr1066 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551907 | NA | 2.70E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551907 | NA | 9.02E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551907 | NA | 5.29E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551907 | 5.40E-11 | 5.40E-11 | mr1881 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551907 | NA | 9.47E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |