Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217449731:

Variant ID: vg1217449731 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17449731
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CATTAACCGTGTCAACCACAAGCCAGCGTGGGCAACGGCTTTACCTATTGTATAGCATGGTTCATTGCGGGGCACCAGACTGAGAAGTGGCGGAGATAAG[T/C]
CCACGGGGGTCGCTGGGGAGTCCATGCCTTGTTTATAAGGGGGTGATTATGATCCAGGAATGGTGCGCTGTGGTGGATTGTGTTGTGCGTGGGGTACTGT

Reverse complement sequence

ACAGTACCCCACGCACAACACAATCCACCACAGCGCACCATTCCTGGATCATAATCACCCCCTTATAAACAAGGCATGGACTCCCCAGCGACCCCCGTGG[A/G]
CTTATCTCCGCCACTTCTCAGTCTGGTGCCCCGCAATGAACCATGCTATACAATAGGTAAAGCCGTTGCCCACGCTGGCTTGTGGTTGACACGGTTAATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.00%	13.50%	57.91%	9.56%	NA
All Indica	2759	5.30%	21.50%	71.77%	1.41%	NA
All Japonica	1512	44.00%	1.30%	31.42%	23.35%	NA
Aus	269	24.20%	5.90%	62.83%	7.06%	NA
Indica I	595	4.50%	25.20%	68.74%	1.51%	NA
Indica II	465	7.10%	9.20%	81.72%	1.94%	NA
Indica III	913	4.20%	27.30%	68.24%	0.33%	NA
Indica Intermediate	786	6.10%	19.30%	72.26%	2.29%	NA
Temperate Japonica	767	77.70%	0.30%	6.13%	15.91%	NA
Tropical Japonica	504	1.20%	2.60%	65.67%	30.56%	NA
Japonica Intermediate	241	26.10%	1.70%	40.25%	31.95%	NA
VI/Aromatic	96	2.10%	2.10%	64.58%	31.25%	NA
Intermediate	90	24.40%	6.70%	56.67%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217449731	T -> C	LOC_Os12g29380.1	downstream_gene_variant ; 3628.0bp to feature; MODIFIER	silent_mutation	Average:20.872; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1217449731	T -> C	LOC_Os12g29370-LOC_Os12g29380	intergenic_region ; MODIFIER	silent_mutation	Average:20.872; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg1217449731	T -> DEL	N	N	silent_mutation	Average:20.872; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217449731	NA	3.26E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	1.08E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	1.05E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	1.49E-06	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	1.93E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	2.14E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	5.92E-07	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	1.60E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	4.93E-15	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	3.56E-08	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	6.41E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	5.25E-06	6.21E-08	mr1388_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	2.71E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	5.44E-08	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	6.20E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	6.23E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	4.33E-07	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	1.58E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	6.72E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217449731	NA	5.67E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251