Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217301806:

Variant ID: vg1217301806 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17301806
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATACTAGTCACACACAAAGTACTATTCATGTATTATCATCTAATAACAATAAAAATACTAATTATAATTATTTCTCAAATAAGAAGAACGGTCAAAC[A/G]
TTGTACATGAACAGTGTTAAAACTACACTTATTTTGGAACGGAGGTAGTAGAAATCCTGCACATATAACTATATAAGGATTCAAAAGTGACGGTTTTAAT

Reverse complement sequence

ATTAAAACCGTCACTTTTGAATCCTTATATAGTTATATGTGCAGGATTTCTACTACCTCCGTTCCAAAATAAGTGTAGTTTTAACACTGTTCATGTACAA[T/C]
GTTTGACCGTTCTTCTTATTTGAGAAATAATTATAATTAGTATTTTTATTGTTATTAGATGATAATACATGAATAGTACTTTGTGTGTGACTAGTATTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.80%	14.60%	0.74%	38.85%	NA
All Indica	2759	37.50%	7.50%	1.01%	54.01%	NA
All Japonica	1512	70.00%	12.60%	0.07%	17.33%	NA
Aus	269	8.20%	81.00%	0.74%	10.04%	NA
Indica I	595	16.10%	0.50%	0.67%	82.69%	NA
Indica II	465	18.50%	18.30%	1.29%	61.94%	NA
Indica III	913	61.90%	4.60%	0.33%	33.19%	NA
Indica Intermediate	786	36.60%	9.70%	1.91%	51.78%	NA
Temperate Japonica	767	96.20%	0.40%	0.00%	3.39%	NA
Tropical Japonica	504	31.00%	30.60%	0.20%	38.29%	NA
Japonica Intermediate	241	68.00%	14.10%	0.00%	17.84%	NA
VI/Aromatic	96	5.20%	59.40%	1.04%	34.38%	NA
Intermediate	90	47.80%	22.20%	3.33%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217301806	A -> DEL	N	N	silent_mutation	Average:18.615; most accessible tissue: Callus, score: 58.592	N	N	N	N
vg1217301806	A -> G	LOC_Os12g29220.1	downstream_gene_variant ; 267.0bp to feature; MODIFIER	silent_mutation	Average:18.615; most accessible tissue: Callus, score: 58.592	N	N	N	N
vg1217301806	A -> G	LOC_Os12g29200-LOC_Os12g29220	intergenic_region ; MODIFIER	silent_mutation	Average:18.615; most accessible tissue: Callus, score: 58.592	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217301806	NA	4.12E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217301806	5.34E-06	NA	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217301806	6.76E-07	7.53E-10	mr1188	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217301806	NA	3.81E-08	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217301806	NA	1.53E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251