Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217057480:

Variant ID: vg1217057480 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17057480
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGGATGTAACCAGTCTGTGACCGGCCTGTTGCCGGTCACATCCGATTGAACGGGCGGCCGTGCCCCCACGTCGCTTCTGTAACAGGCGGAGTGGAAGT[A/T]
GGTATGACCCGTCCCATCAGGGCATAATTCGGGGTTCCCTCCATGAGAGAAGGACCACCACAAGTCTTCACCCATTTATAAGGGAATGACAGGGCTGTCC

Reverse complement sequence

GGACAGCCCTGTCATTCCCTTATAAATGGGTGAAGACTTGTGGTGGTCCTTCTCTCATGGAGGGAACCCCGAATTATGCCCTGATGGGACGGGTCATACC[T/A]
ACTTCCACTCCGCCTGTTACAGAAGCGACGTGGGGGCACGGCCGCCCGTTCAATCGGATGTGACCGGCAACAGGCCGGTCACAGACTGGTTACATCCGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 20.90% 0.36% 18.11% NA
All Indica  2759 48.00% 34.40% 0.51% 17.11% NA
All Japonica  1512 92.70% 0.40% 0.13% 6.81% NA
Aus  269 13.80% 5.60% 0.00% 80.67% NA
Indica I  595 17.00% 77.80% 0.17% 5.04% NA
Indica II  465 58.30% 13.50% 0.65% 27.53% NA
Indica III  913 61.90% 20.60% 0.55% 16.98% NA
Indica Intermediate  786 49.20% 29.90% 0.64% 20.23% NA
Temperate Japonica  767 97.30% 0.40% 0.00% 2.35% NA
Tropical Japonica  504 88.70% 0.20% 0.20% 10.91% NA
Japonica Intermediate  241 86.30% 0.80% 0.41% 12.45% NA
VI/Aromatic  96 34.40% 9.40% 0.00% 56.25% NA
Intermediate  90 78.90% 8.90% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217057480 A -> DEL N N silent_mutation Average:69.695; most accessible tissue: Minghui63 flag leaf, score: 87.052 N N N N
vg1217057480 A -> T LOC_Os12g28850.1 upstream_gene_variant ; 1024.0bp to feature; MODIFIER silent_mutation Average:69.695; most accessible tissue: Minghui63 flag leaf, score: 87.052 N N N N
vg1217057480 A -> T LOC_Os12g28850-LOC_Os12g28860 intergenic_region ; MODIFIER silent_mutation Average:69.695; most accessible tissue: Minghui63 flag leaf, score: 87.052 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217057480 A T -0.02 -0.03 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217057480 NA 4.30E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 4.92E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 7.66E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 8.79E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 4.70E-06 NA mr1314 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 3.04E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 4.67E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 8.44E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 1.58E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 9.22E-11 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 1.67E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 6.43E-10 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 6.23E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 7.91E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217057480 NA 7.82E-06 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251