Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217054183:

Variant ID: vg1217054183 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17054183
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCGAGGCATCGGCCTCCGATACCCGCTGCTCTTGGGCAGCAGCTGCGTCGAGGATACCGCGGGCGTCCTTGATCCTCTTCGCCAGATCCTCGGCATGG[G/C]
CCTCGTACTGAAGGCGATGTCACCCAGTGCTTCGTCCAGGACGCTCGAGGCAATCAGCGCCGCCTGCCGCTCTTCCTCCACCTCTCGCATGACGGAGTCC

Reverse complement sequence

GGACTCCGTCATGCGAGAGGTGGAGGAAGAGCGGCAGGCGGCGCTGATTGCCTCGAGCGTCCTGGACGAAGCACTGGGTGACATCGCCTTCAGTACGAGG[C/G]
CCATGCCGAGGATCTGGCGAAGAGGATCAAGGACGCCCGCGGTATCCTCGACGCAGCTGCTGCCCAAGAGCAGCGGGTATCGGAGGCCGATGCCTCGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 5.20% 5.56% 10.05% NA
All Indica  2759 83.70% 2.20% 2.97% 11.09% NA
All Japonica  1512 82.90% 10.00% 0.20% 6.88% NA
Aus  269 32.30% 0.40% 61.71% 5.58% NA
Indica I  595 95.10% 0.00% 0.34% 4.54% NA
Indica II  465 67.50% 9.50% 5.16% 17.85% NA
Indica III  913 84.90% 0.70% 2.74% 11.72% NA
Indica Intermediate  786 83.30% 1.40% 3.94% 11.32% NA
Temperate Japonica  767 97.50% 0.10% 0.00% 2.35% NA
Tropical Japonica  504 61.70% 27.00% 0.40% 10.91% NA
Japonica Intermediate  241 80.90% 5.80% 0.41% 12.86% NA
VI/Aromatic  96 20.80% 25.00% 8.33% 45.83% NA
Intermediate  90 76.70% 12.20% 4.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217054183 G -> C LOC_Os12g28850.1 missense_variant ; p.Pro666Ala; MODERATE nonsynonymous_codon ; P666A Average:68.88; most accessible tissue: Zhenshan97 flag leaf, score: 87.846 unknown unknown TOLERATED 0.10
vg1217054183 G -> DEL LOC_Os12g28850.1 N frameshift_variant Average:68.88; most accessible tissue: Zhenshan97 flag leaf, score: 87.846 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217054183 G C 0.0 -0.01 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217054183 8.73E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 2.03E-08 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 NA 2.17E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 8.95E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 3.69E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 4.56E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 NA 2.10E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 NA 6.26E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 NA 1.01E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 1.47E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 2.61E-06 2.61E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 1.02E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 NA 1.67E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 2.83E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 9.40E-11 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 1.70E-06 2.47E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 2.19E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 NA 7.96E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 NA 1.06E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217054183 NA 8.54E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251