Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216966466:

Variant ID: vg1216966466 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16966466
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GATTCATCCCAAACCCTAGCCATTGTCGTCACAGCCACCACCACTGTCGTCGTCCTCGTCATCATCGTCGTCGCAGCCGCCGCCGCTCGCTTCCTTCACC[T/C]
AAGGCCGCTGTCACCGTCGTTGTCCTCACATCCGCCGCCATTGCTTGCTCTCGCCGCTTGAGGCCGCCGTCGCAACGCCCCCCGTATTCAGATTGGATAC

Reverse complement sequence

GTATCCAATCTGAATACGGGGGGCGTTGCGACGGCGGCCTCAAGCGGCGAGAGCAAGCAATGGCGGCGGATGTGAGGACAACGACGGTGACAGCGGCCTT[A/G]
GGTGAAGGAAGCGAGCGGCGGCGGCTGCGACGACGATGATGACGAGGACGACGACAGTGGTGGTGGCTGTGACGACAATGGCTAGGGTTTGGGATGAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.80% 32.40% 0.34% 20.50% NA
All Indica  2759 61.30% 11.50% 0.54% 26.64% NA
All Japonica  1512 19.60% 73.90% 0.07% 6.42% NA
Aus  269 55.00% 16.40% 0.00% 28.62% NA
Indica I  595 86.70% 9.40% 0.17% 3.70% NA
Indica II  465 28.00% 9.70% 1.72% 60.65% NA
Indica III  913 66.30% 12.70% 0.44% 20.59% NA
Indica Intermediate  786 56.00% 12.80% 0.25% 30.92% NA
Temperate Japonica  767 1.00% 96.20% 0.00% 2.74% NA
Tropical Japonica  504 51.00% 37.70% 0.20% 11.11% NA
Japonica Intermediate  241 12.90% 78.80% 0.00% 8.30% NA
VI/Aromatic  96 33.30% 13.50% 0.00% 53.12% NA
Intermediate  90 48.90% 41.10% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216966466 T -> C LOC_Os12g28710.1 downstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:75.98; most accessible tissue: Zhenshan97 panicle, score: 91.693 N N N N
vg1216966466 T -> C LOC_Os12g28720.1 downstream_gene_variant ; 139.0bp to feature; MODIFIER silent_mutation Average:75.98; most accessible tissue: Zhenshan97 panicle, score: 91.693 N N N N
vg1216966466 T -> C LOC_Os12g28710-LOC_Os12g28720 intergenic_region ; MODIFIER silent_mutation Average:75.98; most accessible tissue: Zhenshan97 panicle, score: 91.693 N N N N
vg1216966466 T -> DEL N N silent_mutation Average:75.98; most accessible tissue: Zhenshan97 panicle, score: 91.693 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216966466 T C -0.01 -0.01 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216966466 NA 6.26E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 NA 4.53E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 NA 7.10E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 2.66E-06 2.66E-06 mr1419_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 3.35E-06 3.34E-06 mr1488_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 NA 6.20E-07 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 NA 2.03E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 NA 4.16E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 2.03E-06 2.03E-06 mr1764_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 NA 8.19E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216966466 NA 6.36E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251