| Variant ID: vg1216723603 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16723603 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTTGAGAGATTCCAGGACACCAATCTTCGGCCGACTGGTCCTGATAACTCTGATGATGAAAAAACTGATACCGATTGATGTAATTTGATAACAATGATT[C/T]
TGATGATGATGATGGAGGCACAATTTGTACAATACTGATGAATTTATGCTGTGCTCAGTATTTCAAACTTAGCTTCTGATTTCTTAAAAGCTTTTGTCAA
TTGACAAAAGCTTTTAAGAAATCAGAAGCTAAGTTTGAAATACTGAGCACAGCATAAATTCATCAGTATTGTACAAATTGTGCCTCCATCATCATCATCA[G/A]
AATCATTGTTATCAAATTACATCAATCGGTATCAGTTTTTTCATCATCAGAGTTATCAGGACCAGTCGGCCGAAGATTGGTGTCCTGGAATCTCTCAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 1.30% | 8.40% | 5.04% | NA |
| All Indica | 2759 | 81.00% | 1.90% | 12.54% | 4.57% | NA |
| All Japonica | 1512 | 92.90% | 0.00% | 1.26% | 5.89% | NA |
| Aus | 269 | 84.00% | 2.20% | 8.92% | 4.83% | NA |
| Indica I | 595 | 74.30% | 1.70% | 21.85% | 2.18% | NA |
| Indica II | 465 | 81.30% | 2.60% | 10.75% | 5.38% | NA |
| Indica III | 913 | 86.50% | 1.60% | 5.91% | 5.91% | NA |
| Indica Intermediate | 786 | 79.40% | 2.00% | 14.25% | 4.33% | NA |
| Temperate Japonica | 767 | 97.50% | 0.00% | 1.17% | 1.30% | NA |
| Tropical Japonica | 504 | 84.90% | 0.00% | 1.19% | 13.89% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 1.66% | 3.73% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 4.17% | 8.33% | NA |
| Intermediate | 90 | 92.20% | 1.10% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216723603 | C -> DEL | N | N | silent_mutation | Average:6.223; most accessible tissue: Callus, score: 9.391 | N | N | N | N |
| vg1216723603 | C -> T | LOC_Os12g28280.1 | downstream_gene_variant ; 22.0bp to feature; MODIFIER | silent_mutation | Average:6.223; most accessible tissue: Callus, score: 9.391 | N | N | N | N |
| vg1216723603 | C -> T | LOC_Os12g28290.1 | downstream_gene_variant ; 4702.0bp to feature; MODIFIER | silent_mutation | Average:6.223; most accessible tissue: Callus, score: 9.391 | N | N | N | N |
| vg1216723603 | C -> T | LOC_Os12g28280-LOC_Os12g28290 | intergenic_region ; MODIFIER | silent_mutation | Average:6.223; most accessible tissue: Callus, score: 9.391 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216723603 | NA | 1.45E-09 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216723603 | 7.75E-06 | 3.86E-10 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216723603 | NA | 4.88E-06 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216723603 | 1.82E-07 | 2.42E-10 | mr1818_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216723603 | NA | 8.93E-12 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216723603 | 9.22E-08 | 1.78E-10 | mr1897_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216723603 | 4.06E-07 | 5.05E-10 | mr1914_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216723603 | NA | 1.54E-08 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |