Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216602715:

Variant ID: vg1216602715 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16602715
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AAACATTATGAGTACAATAGGTGAAACATTTTTGGTGGAACAAAAAATGAAACGAATTCTCTTAATAGAGGGTTTTCAAAATATATGTGGGTGATTTGTT[G/A]
CAAAAGAATACTTTAATTCACTGCAACATTATATCTATACATAGTGAAACATTGTGAGTACACTAGGTAAAACATTTTTTGTGGAACAAAAAATGAAACG

Reverse complement sequence

CGTTTCATTTTTTGTTCCACAAAAAATGTTTTACCTAGTGTACTCACAATGTTTCACTATGTATAGATATAATGTTGCAGTGAATTAAAGTATTCTTTTG[C/T]
AACAAATCACCCACATATATTTTGAAAACCCTCTATTAAGAGAATTCGTTTCATTTTTTGTTCCACCAAAAATGTTTCACCTATTGTACTCATAATGTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.00%	25.40%	2.09%	10.45%	NA
All Indica	2759	45.10%	42.60%	1.59%	10.76%	NA
All Japonica	1512	93.10%	0.80%	2.78%	3.37%	NA
Aus	269	45.70%	0.70%	3.35%	50.19%	NA
Indica I	595	21.80%	71.80%	0.50%	5.88%	NA
Indica II	465	28.20%	52.30%	0.65%	18.92%	NA
Indica III	913	68.60%	18.80%	2.96%	9.64%	NA
Indica Intermediate	786	45.30%	42.40%	1.40%	10.94%	NA
Temperate Japonica	767	96.70%	0.90%	1.43%	0.91%	NA
Tropical Japonica	504	86.30%	0.60%	5.95%	7.14%	NA
Japonica Intermediate	241	95.40%	0.80%	0.41%	3.32%	NA
VI/Aromatic	96	92.70%	2.10%	1.04%	4.17%	NA
Intermediate	90	77.80%	11.10%	3.33%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216602715	G -> DEL	N	N	silent_mutation	Average:8.46; most accessible tissue: Zhenshan97 flower, score: 15.748	N	N	N	N
vg1216602715	G -> A	LOC_Os12g28110.1	downstream_gene_variant ; 3797.0bp to feature; MODIFIER	silent_mutation	Average:8.46; most accessible tissue: Zhenshan97 flower, score: 15.748	N	N	N	N
vg1216602715	G -> A	LOC_Os12g28110-LOC_Os12g28137	intergenic_region ; MODIFIER	silent_mutation	Average:8.46; most accessible tissue: Zhenshan97 flower, score: 15.748	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216602715	NA	2.37E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602715	5.85E-08	NA	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602715	7.56E-08	3.09E-08	mr1458_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602715	NA	3.66E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251