Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216517225:

Variant ID: vg1216517225 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16517225
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.26, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ACAACGAATGCCTCGAGCACTCGTGTCAAATCAAATATTTGAATCCAGGTTGACTGGTTCCACCATAAGAAACCTATCCGGTTAAATTATACCCACTTTA[T/C]
ATTTGTGGGAATATACTTGTCTATTGTTATATGAGGAAAATGTGTGGAGTTTAACAAATCATAAAAATAAATCTTATTAATTTTGTGAGAGTGAGTATTG

Reverse complement sequence

CAATACTCACTCTCACAAAATTAATAAGATTTATTTTTATGATTTGTTAAACTCCACACATTTTCCTCATATAACAATAGACAAGTATATTCCCACAAAT[A/G]
TAAAGTGGGTATAATTTAACCGGATAGGTTTCTTATGGTGGAACCAGTCAACCTGGATTCAAATATTTGATTTGACACGAGTGCTCGAGGCATTCGTTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	21.90%	22.85%	6.96%	NA
All Indica	2759	53.10%	8.20%	34.32%	4.31%	NA
All Japonica	1512	34.20%	51.10%	3.64%	11.11%	NA
Aus	269	68.40%	2.20%	20.82%	8.55%	NA
Indica I	595	46.40%	2.40%	49.92%	1.34%	NA
Indica II	465	31.40%	5.60%	49.89%	13.12%	NA
Indica III	913	72.60%	12.90%	14.02%	0.44%	NA
Indica Intermediate	786	48.50%	8.80%	36.90%	5.85%	NA
Temperate Japonica	767	21.00%	76.50%	2.22%	0.26%	NA
Tropical Japonica	504	48.20%	14.90%	5.16%	31.75%	NA
Japonica Intermediate	241	46.90%	45.60%	4.98%	2.49%	NA
VI/Aromatic	96	77.10%	1.00%	6.25%	15.62%	NA
Intermediate	90	46.70%	31.10%	17.78%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216517225	T -> C	LOC_Os12g28010.1	upstream_gene_variant ; 1750.0bp to feature; MODIFIER	silent_mutation	Average:24.913; most accessible tissue: Callus, score: 52.029	N	N	N	N
vg1216517225	T -> C	LOC_Os12g28015.1	upstream_gene_variant ; 2486.0bp to feature; MODIFIER	silent_mutation	Average:24.913; most accessible tissue: Callus, score: 52.029	N	N	N	N
vg1216517225	T -> C	LOC_Os12g28010-LOC_Os12g28015	intergenic_region ; MODIFIER	silent_mutation	Average:24.913; most accessible tissue: Callus, score: 52.029	N	N	N	N
vg1216517225	T -> DEL	N	N	silent_mutation	Average:24.913; most accessible tissue: Callus, score: 52.029	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216517225	1.19E-06	1.19E-06	mr1610	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216517225	NA	1.51E-08	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216517225	NA	5.57E-07	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216517225	NA	3.06E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216517225	NA	1.59E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216517225	NA	1.54E-06	mr1219_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216517225	NA	5.44E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216517225	NA	1.09E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216517225	NA	1.01E-06	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251