Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216418473:

Variant ID: vg1216418473 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16418473
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AAATAATCTAAGTAAAATCCAACCCTAAATTAACAACAGCTATTGAATATATAGGTTATAGGGTCGACCTTGGACCCCTGAACTGAGTCCCTATCGGACT[C/T]
TGACATGATACTTGTCCAATAGTCCAAAGATGATGGCGCAGCACCCGGACAGATTCTAGACCCTTTCTTGTTTTGACTATTCTCGTCAGCTTGGAAGGAA

Reverse complement sequence

TTCCTTCCAAGCTGACGAGAATAGTCAAAACAAGAAAGGGTCTAGAATCTGTCCGGGTGCTGCGCCATCATCTTTGGACTATTGGACAAGTATCATGTCA[G/A]
AGTCCGATAGGGACTCAGTTCAGGGGTCCAAGGTCGACCCTATAACCTATATATTCAATAGCTGTTGTTAATTTAGGGTTGGATTTTACTTAGATTATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.40%	39.90%	0.49%	14.22%	NA
All Indica	2759	31.10%	54.50%	0.54%	13.88%	NA
All Japonica	1512	77.60%	11.70%	0.33%	10.32%	NA
Aus	269	10.40%	61.00%	0.74%	27.88%	NA
Indica I	595	21.70%	72.90%	0.84%	4.54%	NA
Indica II	465	68.60%	19.60%	1.51%	10.32%	NA
Indica III	913	13.90%	63.70%	0.22%	22.12%	NA
Indica Intermediate	786	36.00%	50.40%	0.13%	13.49%	NA
Temperate Japonica	767	89.30%	1.80%	0.26%	8.60%	NA
Tropical Japonica	504	61.70%	27.40%	0.60%	10.32%	NA
Japonica Intermediate	241	73.90%	10.40%	0.00%	15.77%	NA
VI/Aromatic	96	30.20%	16.70%	1.04%	52.08%	NA
Intermediate	90	61.10%	30.00%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216418473	C -> DEL	N	N	silent_mutation	Average:40.16; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N
vg1216418473	C -> T	LOC_Os12g27860.1	upstream_gene_variant ; 4422.0bp to feature; MODIFIER	silent_mutation	Average:40.16; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N
vg1216418473	C -> T	LOC_Os12g27850.1	downstream_gene_variant ; 4863.0bp to feature; MODIFIER	silent_mutation	Average:40.16; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N
vg1216418473	C -> T	LOC_Os12g27850-LOC_Os12g27860	intergenic_region ; MODIFIER	silent_mutation	Average:40.16; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216418473	4.25E-06	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	NA	7.18E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	6.05E-09	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	3.74E-06	NA	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	6.22E-06	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	4.22E-07	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	1.85E-06	NA	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	2.41E-08	NA	mr1390_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	1.05E-06	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	8.81E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216418473	1.65E-06	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251