Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216261360:

Variant ID: vg1216261360 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 16261360
Reference Allele: GTCCA	Alternative Allele: ATCCA,G
Primary Allele: GTCCA	Secondary Allele: ATCCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAATGTTTACTATAGCACCACATTGTCAAATTATGGCATAATTAAGCTTAAAAAATTTGTCTTGCAATTTACATGCAAACTATGCAATTAGTTTTTTTC[GTCCA/ATCCA,G]
TATTTAATGTTACATGGATTTGTCCAAACATAAGATGGGACAGAAGTTTTAGAAGTTTAAAGGAAACTCTAAACACAGCCTCTTTTTGGATTTTTTTTTT

Reverse complement sequence

AAAAAAAAAATCCAAAAAGAGGCTGTGTTTAGAGTTTCCTTTAAACTTCTAAAACTTCTGTCCCATCTTATGTTTGGACAAATCCATGTAACATTAAATA[TGGAC/TGGAT,C]
GAAAAAAACTAATTGCATAGTTTGCATGTAAATTGCAAGACAAATTTTTTAAGCTTAATTATGCCATAATTTGACAATGTGGTGCTATAGTAAACATTTG

Allele Frequencies:

Populations	Population Size	Frequency of GTCCA(primary allele)	Frequency of ATCCA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	22.30%	1.80%	9.94%	G: 3.51%
All Indica	2759	47.60%	37.30%	2.65%	11.82%	G: 0.65%
All Japonica	1512	92.50%	0.90%	0.26%	0.07%	G: 6.28%
Aus	269	31.20%	0.70%	1.49%	52.04%	G: 14.50%
Indica I	595	31.90%	55.10%	3.70%	9.24%	NA
Indica II	465	26.70%	40.00%	5.81%	27.31%	G: 0.22%
Indica III	913	70.30%	22.30%	0.77%	5.70%	G: 0.88%
Indica Intermediate	786	45.50%	39.40%	2.16%	11.70%	G: 1.15%
Temperate Japonica	767	96.60%	0.90%	0.13%	0.00%	G: 2.35%
Tropical Japonica	504	86.50%	1.00%	0.60%	0.00%	G: 11.90%
Japonica Intermediate	241	91.70%	0.80%	0.00%	0.41%	G: 7.05%
VI/Aromatic	96	89.60%	2.10%	0.00%	0.00%	G: 8.33%
Intermediate	90	76.70%	8.90%	4.44%	3.33%	G: 6.67%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216261360	GTCCA -> DEL	N	N	silent_mutation	Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg1216261360	GTCCA -> G	LOC_Os12g27630.1	downstream_gene_variant ; 1354.0bp to feature; MODIFIER	silent_mutation	Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg1216261360	GTCCA -> G	LOC_Os12g27610-LOC_Os12g27630	intergenic_region ; MODIFIER	silent_mutation	Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg1216261360	GTCCA -> ATCCA	LOC_Os12g27630.1	downstream_gene_variant ; 1355.0bp to feature; MODIFIER	silent_mutation	Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N
vg1216261360	GTCCA -> ATCCA	LOC_Os12g27610-LOC_Os12g27630	intergenic_region ; MODIFIER	silent_mutation	Average:41.46; most accessible tissue: Minghui63 panicle, score: 84.552	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1216261360	GTCCA	ATCCA	0.02	0.01	0.0	0.01	0.01	0.02
vg1216261360	GTCCA	G	-0.17	0.0	0.0	-0.08	-0.1	-0.11

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216261360	NA	2.17E-13	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	1.39E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	1.81E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	1.41E-11	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	5.43E-06	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	2.51E-07	1.66E-12	mr1178	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	1.80E-09	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	2.10E-06	mr1610	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	6.12E-06	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	1.23E-09	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	1.31E-12	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216261360	NA	8.31E-13	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251