Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216136207:

Variant ID: vg1216136207 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16136207
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GTCACAAGTTGAGTTTAAAGATGGGGACTCACAATTCTGGGCCAGCCTTATGAAGGTCAAGCGTGACTTTTTACTATTTGGCAAATTCATTATGAGAGAT[G/A]
GTGCCCAAATCAGGTTTTGGGAAGACAAGTGGTTGGGAGAAGCACCATTGCAAGAACAATATCCTTGTCTATACAATATAGTTAGGAATAAACATGATAC

Reverse complement sequence

GTATCATGTTTATTCCTAACTATATTGTATAGACAAGGATATTGTTCTTGCAATGGTGCTTCTCCCAACCACTTGTCTTCCCAAAACCTGATTTGGGCAC[C/T]
ATCTCTCATAATGAATTTGCCAAATAGTAAAAAGTCACGCTTGACCTTCATAAGGCTGGCCCAGAATTGTGAGTCCCCATCTTTAAACTCAACTTGTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	4.70%	8.44%	0.08%	NA
All Indica	2759	83.70%	4.70%	11.60%	0.00%	NA
All Japonica	1512	89.40%	5.80%	4.56%	0.26%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	79.50%	6.20%	14.29%	0.00%	NA
Indica II	465	92.30%	3.00%	4.73%	0.00%	NA
Indica III	913	83.10%	3.80%	13.03%	0.00%	NA
Indica Intermediate	786	82.30%	5.70%	11.96%	0.00%	NA
Temperate Japonica	767	98.40%	0.40%	1.04%	0.13%	NA
Tropical Japonica	504	75.40%	14.50%	9.72%	0.40%	NA
Japonica Intermediate	241	89.60%	5.00%	4.98%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	88.90%	2.20%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216136207	G -> DEL	N	N	silent_mutation	Average:10.659; most accessible tissue: Callus, score: 14.169	N	N	N	N
vg1216136207	G -> A	LOC_Os12g27400.1	upstream_gene_variant ; 3924.0bp to feature; MODIFIER	silent_mutation	Average:10.659; most accessible tissue: Callus, score: 14.169	N	N	N	N
vg1216136207	G -> A	LOC_Os12g27420.1	downstream_gene_variant ; 3632.0bp to feature; MODIFIER	silent_mutation	Average:10.659; most accessible tissue: Callus, score: 14.169	N	N	N	N
vg1216136207	G -> A	LOC_Os12g27410.1	intron_variant ; MODIFIER	silent_mutation	Average:10.659; most accessible tissue: Callus, score: 14.169	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216136207	8.49E-06	5.42E-07	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216136207	6.05E-06	6.05E-06	mr1891	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216136207	9.97E-07	NA	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216136207	2.96E-07	NA	mr1132_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216136207	4.03E-06	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251