| Variant ID: vg1216110707 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16110707 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, G: 0.29, others allele: 0.00, population size: 55. )
CTTAGTCTCAGTACTTATTAGGATACAATACTGAATAGTTCGCAATACATGACTACTAATTTCATCACATTACATGACTGGAATACTTAGTCTCAGTACT[A/G]
ATTAGGATACAATAGTGCTCGAGTTCATGGTTCAATAACAATATTAGACCATCGCATCGCCTGCCGCACGAGGACGCCTGGGACGTGCTCGCCTGGTTGT
ACAACCAGGCGAGCACGTCCCAGGCGTCCTCGTGCGGCAGGCGATGCGATGGTCTAATATTGTTATTGAACCATGAACTCGAGCACTATTGTATCCTAAT[T/C]
AGTACTGAGACTAAGTATTCCAGTCATGTAATGTGATGAAATTAGTAGTCATGTATTGCGAACTATTCAGTATTGTATCCTAATAAGTACTGAGACTAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.70% | 19.30% | 1.74% | 48.24% | NA |
| All Indica | 2759 | 9.50% | 32.20% | 2.83% | 55.49% | NA |
| All Japonica | 1512 | 65.70% | 0.30% | 0.26% | 33.66% | NA |
| Aus | 269 | 25.70% | 0.70% | 0.00% | 73.61% | NA |
| Indica I | 595 | 15.80% | 1.20% | 1.51% | 81.51% | NA |
| Indica II | 465 | 10.10% | 73.50% | 1.94% | 14.41% | NA |
| Indica III | 913 | 2.40% | 35.80% | 4.38% | 57.39% | NA |
| Indica Intermediate | 786 | 12.60% | 27.00% | 2.54% | 57.89% | NA |
| Temperate Japonica | 767 | 95.80% | 0.00% | 0.13% | 4.04% | NA |
| Tropical Japonica | 504 | 15.30% | 0.80% | 0.60% | 83.33% | NA |
| Japonica Intermediate | 241 | 75.50% | 0.40% | 0.00% | 24.07% | NA |
| VI/Aromatic | 96 | 82.30% | 0.00% | 0.00% | 17.71% | NA |
| Intermediate | 90 | 54.40% | 17.80% | 0.00% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216110707 | A -> DEL | N | N | silent_mutation | Average:36.008; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg1216110707 | A -> G | LOC_Os12g27390.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.008; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216110707 | NA | 3.37E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216110707 | NA | 5.20E-07 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216110707 | NA | 7.69E-06 | mr1294_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216110707 | NA | 1.84E-07 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216110707 | NA | 5.00E-07 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216110707 | NA | 4.15E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |