Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216087306:

Variant ID: vg1216087306 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16087306
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAATTAGGGGCCTCCAAAATATGTATACTATGGTACCAAATCTGATAGGCTACTTTGTGCATTGAGAAGATGCTGCTAGATGAGATTGTTATTGACAC[T/C]
ATCATCACTGATTTTGCATCTAGAACTGTTAGAAAAATTGTTTTAAATGATTTAGAGATATTTCTTTTAGTATTTTAAACTTATTAGTGTGAAATTCGTT

Reverse complement sequence

AACGAATTTCACACTAATAAGTTTAAAATACTAAAAGAAATATCTCTAAATCATTTAAAACAATTTTTCTAACAGTTCTAGATGCAAAATCAGTGATGAT[A/G]
GTGTCAATAACAATCTCATCTAGCAGCATCTTCTCAATGCACAAAGTAGCCTATCAGATTTGGTACCATAGTATACATATTTTGGAGGCCCCTAATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	0.30%	6.96%	31.55%	NA
All Indica	2759	47.20%	0.40%	10.58%	41.90%	NA
All Japonica	1512	86.80%	0.00%	0.73%	12.43%	NA
Aus	269	44.60%	0.70%	7.43%	47.21%	NA
Indica I	595	42.20%	0.50%	15.63%	41.68%	NA
Indica II	465	72.70%	0.00%	10.11%	17.20%	NA
Indica III	913	34.10%	0.10%	8.32%	57.50%	NA
Indica Intermediate	786	51.00%	0.80%	9.67%	38.55%	NA
Temperate Japonica	767	97.00%	0.00%	0.00%	3.00%	NA
Tropical Japonica	504	70.00%	0.00%	1.79%	28.17%	NA
Japonica Intermediate	241	89.60%	0.00%	0.83%	9.54%	NA
VI/Aromatic	96	92.70%	0.00%	1.04%	6.25%	NA
Intermediate	90	78.90%	0.00%	5.56%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216087306	T -> C	LOC_Os12g27370.1	upstream_gene_variant ; 4975.0bp to feature; MODIFIER	silent_mutation	Average:20.149; most accessible tissue: Callus, score: 44.319	N	N	N	N
vg1216087306	T -> C	LOC_Os12g27350-LOC_Os12g27370	intergenic_region ; MODIFIER	silent_mutation	Average:20.149; most accessible tissue: Callus, score: 44.319	N	N	N	N
vg1216087306	T -> DEL	N	N	silent_mutation	Average:20.149; most accessible tissue: Callus, score: 44.319	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216087306	3.02E-06	5.09E-06	mr1946	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251