Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215815980:

Variant ID: vg1215815980 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15815980
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTCAAGATCTACTAGTTTTATTTTGGTCATTTTTCTATATAATTTTTTTCCCAACAACTTGAAATTGATTTTGACAATATAACAAATCTAATTAACAG[C/T]
ATTTGTAAATACTACATGATTTCAAATTGAAATATGGTCAAAAACAAAGTTGATCCTCTCATCAGGATCTACAACTTTTATTTTGGTCATTTGTAATAAA

Reverse complement sequence

TTTATTACAAATGACCAAAATAAAAGTTGTAGATCCTGATGAGAGGATCAACTTTGTTTTTGACCATATTTCAATTTGAAATCATGTAGTATTTACAAAT[G/A]
CTGTTAATTAGATTTGTTATATTGTCAAAATCAATTTCAAGTTGTTGGGAAAAAAATTATATAGAAAAATGACCAAAATAAAACTAGTAGATCTTGAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.50%	31.40%	0.11%	0.00%	NA
All Indica	2759	47.80%	52.00%	0.14%	0.00%	NA
All Japonica	1512	97.90%	2.00%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	71.80%	28.10%	0.17%	0.00%	NA
Indica II	465	50.50%	49.50%	0.00%	0.00%	NA
Indica III	913	29.60%	70.40%	0.00%	0.00%	NA
Indica Intermediate	786	49.40%	50.30%	0.38%	0.00%	NA
Temperate Japonica	767	97.80%	2.20%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215815980	C -> T	LOC_Os12g26990.1	upstream_gene_variant ; 4769.0bp to feature; MODIFIER	silent_mutation	Average:18.401; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1215815980	C -> T	LOC_Os12g27000.1	upstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:18.401; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1215815980	C -> T	LOC_Os12g27010.1	downstream_gene_variant ; 144.0bp to feature; MODIFIER	silent_mutation	Average:18.401; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1215815980	C -> T	LOC_Os12g27000-LOC_Os12g27010	intergenic_region ; MODIFIER	silent_mutation	Average:18.401; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215815980	5.59E-06	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215815980	6.88E-07	NA	mr1132_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215815980	5.15E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251