Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215794902:

Variant ID: vg1215794902 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15794902
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTATAATTATTGTATGACTGTCATTATTGTAAGAATAATTATTTGTGTATGATTTTTTTTCATGTCATGTAGATGGATCGGCAATGGATGTACGCTGA[T/C]
CGGCGGTCCAAAGAGTTTATTGATGGCGTGCATGATTTTTTGAGAGTGGCCGAAGCTAACAGGCATAAGGGTTTTATTTGTTGTCCATGCAATAAGTGTA

Reverse complement sequence

TACACTTATTGCATGGACAACAAATAAAACCCTTATGCCTGTTAGCTTCGGCCACTCTCAAAAAATCATGCACGCCATCAATAAACTCTTTGGACCGCCG[A/G]
TCAGCGTACATCCATTGCCGATCCATCTACATGACATGAAAAAAAATCATACACAAATAATTATTCTTACAATAATGACAGTCATACAATAATTATAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.20% 10.00% 45.28% 27.53% NA
All Indica  2759 4.80% 3.80% 47.52% 43.93% NA
All Japonica  1512 43.50% 16.70% 35.71% 4.03% NA
Aus  269 0.70% 24.50% 72.49% 2.23% NA
Indica I  595 1.70% 1.20% 29.08% 68.07% NA
Indica II  465 14.60% 3.20% 49.89% 32.26% NA
Indica III  913 0.50% 5.90% 56.41% 37.13% NA
Indica Intermediate  786 6.20% 3.60% 49.75% 40.46% NA
Temperate Japonica  767 78.60% 10.80% 8.08% 2.48% NA
Tropical Japonica  504 1.20% 11.90% 81.15% 5.75% NA
Japonica Intermediate  241 20.30% 45.60% 28.63% 5.39% NA
VI/Aromatic  96 0.00% 36.50% 56.25% 7.29% NA
Intermediate  90 23.30% 15.60% 44.44% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215794902 T -> C LOC_Os12g26970.1 synonymous_variant ; p.Asp76Asp; LOW synonymous_codon Average:12.792; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1215794902 T -> C LOC_Os12g26970.1 synonymous_variant ; p.Asp76Asp; LOW nonsynonymous_codon ; D76G Average:12.792; most accessible tissue: Minghui63 panicle, score: 20.733 possibly damaging 1.539 DELETERIOUS 0.01
vg1215794902 T -> DEL LOC_Os12g26970.1 N frameshift_variant Average:12.792; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215794902 NA 7.41E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1215794902 NA 2.90E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 6.09E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 4.71E-07 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 4.85E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 1.17E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 2.26E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 2.44E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 3.03E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 1.94E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 4.79E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 1.32E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 2.67E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 9.95E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 8.38E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 4.24E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 3.81E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 1.85E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 1.38E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 6.21E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 3.75E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 5.44E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 1.48E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 1.47E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 7.33E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 5.33E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 8.56E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 5.86E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 1.98E-11 mr1805_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 3.06E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 5.27E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 3.92E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215794902 NA 8.09E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251