| Variant ID: vg1215769535 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15769535 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGCGGCAGGGGCGGCTGGATTTTGCCAGCGGCGTAGGAGAGAGAGGAGGTCGGCGACGGTGTGGCTAGGGAGCTCGGGAAGGGGGAAAACCGAAGGAGA[G/T]
GGGGACTAGGGCTCCATTTTATAGGCAATGGAGGGGAGTGCCGACCACAGGAGGGGACGGGAACGACGCCGGAGAACGTGGCCAGCGGCATCAATGGCGG
CCGCCATTGATGCCGCTGGCCACGTTCTCCGGCGTCGTTCCCGTCCCCTCCTGTGGTCGGCACTCCCCTCCATTGCCTATAAAATGGAGCCCTAGTCCCC[C/A]
TCTCCTTCGGTTTTCCCCCTTCCCGAGCTCCCTAGCCACACCGTCGCCGACCTCCTCTCTCTCCTACGCCGCTGGCAAAATCCAGCCGCCCCTGCCGCCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 1.00% | 0.89% | 3.36% | NA |
| All Indica | 2759 | 94.10% | 1.20% | 0.87% | 3.84% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.07% | 0.07% | NA |
| Aus | 269 | 71.00% | 4.10% | 5.95% | 18.96% | NA |
| Indica I | 595 | 98.30% | 0.30% | 1.18% | 0.17% | NA |
| Indica II | 465 | 81.50% | 1.50% | 0.43% | 16.56% | NA |
| Indica III | 913 | 97.40% | 1.30% | 0.77% | 0.55% | NA |
| Indica Intermediate | 786 | 94.70% | 1.40% | 1.02% | 2.93% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215769535 | G -> DEL | LOC_Os12g26910.1 | N | frameshift_variant | Average:70.234; most accessible tissue: Zhenshan97 flag leaf, score: 85.761 | N | N | N | N |
| vg1215769535 | G -> T | LOC_Os12g26910.1 | missense_variant ; p.Glu198Asp; MODERATE | nonsynonymous_codon ; E198D | Average:70.234; most accessible tissue: Zhenshan97 flag leaf, score: 85.761 | unknown | unknown | TOLERATED | 0.54 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215769535 | NA | 3.05E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215769535 | 3.03E-06 | 3.03E-06 | mr1329 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215769535 | NA | 3.40E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215769535 | NA | 1.80E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215769535 | NA | 7.43E-08 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |