Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215651261:

Variant ID: vg1215651261 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15651261
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCTTTTTCTTAGTTTTCTCTATTAGATGAAAATCGATTAAAGTTCAGAAATTCATAACTAAATCATCGTAACTCCGATTCTAGTGGTTCAAGTTGCTA[T/A]
ATTCATCTAAAATCGAGATCTACATGTTAAAAATATCCACATGTACTATTTATGCTTGTTTTTGTACTGTTTTGTTGATTTTATTCTTTTGCTTTAGTTT

Reverse complement sequence

AAACTAAAGCAAAAGAATAAAATCAACAAAACAGTACAAAAACAAGCATAAATAGTACATGTGGATATTTTTAACATGTAGATCTCGATTTTAGATGAAT[A/T]
TAGCAACTTGAACCACTAGAATCGGAGTTACGATGATTTAGTTATGAATTTCTGAACTTTAATCGATTTTCATCTAATAGAGAAAACTAAGAAAAAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.20%	17.40%	0.28%	57.13%	NA
All Indica	2759	8.40%	7.00%	0.29%	84.31%	NA
All Japonica	1512	59.50%	29.20%	0.07%	11.18%	NA
Aus	269	7.40%	37.90%	0.00%	54.65%	NA
Indica I	595	8.70%	0.30%	0.34%	90.59%	NA
Indica II	465	15.70%	26.00%	0.65%	57.63%	NA
Indica III	913	1.60%	2.40%	0.00%	95.95%	NA
Indica Intermediate	786	11.70%	6.10%	0.38%	81.81%	NA
Temperate Japonica	767	91.30%	4.40%	0.13%	4.17%	NA
Tropical Japonica	504	10.10%	69.40%	0.00%	20.44%	NA
Japonica Intermediate	241	61.80%	24.10%	0.00%	14.11%	NA
VI/Aromatic	96	9.40%	59.40%	2.08%	29.17%	NA
Intermediate	90	31.10%	33.30%	2.22%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215651261	T -> DEL	N	N	silent_mutation	Average:28.287; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg1215651261	T -> A	LOC_Os12g26700.1	downstream_gene_variant ; 4238.0bp to feature; MODIFIER	silent_mutation	Average:28.287; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg1215651261	T -> A	LOC_Os12g26710.1	intron_variant ; MODIFIER	silent_mutation	Average:28.287; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215651261	5.14E-06	NA	mr1228	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215651261	NA	5.18E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251