Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215354093:

Variant ID: vg1215354093 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15354093
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTTCATTCCTGATATCAAGACCATCTTCTACACAAGAAGTGATCTCAAGACACAAAAGCTCAATCAATTTTTTTTTAATTTACATTTTAGTGACATAT[A/G]
TTTGGCTATAAATTAGCCAACTACCCATCACCTAATGTTGCGAGAATCTAAGATATTGAGCTCACTCCTAAGCTCGCAAAATCTTTTCTCGTCTAAGGGC

Reverse complement sequence

GCCCTTAGACGAGAAAAGATTTTGCGAGCTTAGGAGTGAGCTCAATATCTTAGATTCTCGCAACATTAGGTGATGGGTAGTTGGCTAATTTATAGCCAAA[T/C]
ATATGTCACTAAAATGTAAATTAAAAAAAAATTGATTGAGCTTTTGTGTCTTGAGATCACTTCTTGTGTAGAAGATGGTCTTGATATCAGGAATGAAGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	1.70%	14.11%	45.11%	NA
All Indica	2759	22.80%	2.80%	17.29%	57.19%	NA
All Japonica	1512	69.50%	0.00%	2.31%	28.17%	NA
Aus	269	36.80%	1.10%	50.19%	11.90%	NA
Indica I	595	8.10%	5.70%	15.97%	70.25%	NA
Indica II	465	29.70%	2.40%	13.55%	54.41%	NA
Indica III	913	24.10%	1.60%	19.72%	54.55%	NA
Indica Intermediate	786	28.20%	2.00%	17.68%	52.04%	NA
Temperate Japonica	767	92.40%	0.00%	0.39%	7.17%	NA
Tropical Japonica	504	36.30%	0.00%	5.75%	57.94%	NA
Japonica Intermediate	241	66.00%	0.00%	1.24%	32.78%	NA
VI/Aromatic	96	15.60%	2.10%	14.58%	67.71%	NA
Intermediate	90	57.80%	1.10%	6.67%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215354093	A -> DEL	N	N	silent_mutation	Average:12.896; most accessible tissue: Callus, score: 30.602	N	N	N	N
vg1215354093	A -> G	LOC_Os12g26310.1	intron_variant ; MODIFIER	silent_mutation	Average:12.896; most accessible tissue: Callus, score: 30.602	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215354093	NA	9.99E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	7.98E-06	mr1111	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	9.36E-12	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	2.42E-13	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	4.43E-13	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	7.52E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	1.66E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	2.50E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	5.27E-06	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	1.95E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	1.78E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	1.84E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	2.67E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	1.61E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	9.59E-09	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	1.66E-07	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	8.52E-07	8.52E-07	mr1407_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	2.42E-06	2.42E-06	mr1511_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	2.24E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	3.46E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	2.57E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	2.59E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	2.56E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	5.17E-06	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	1.92E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	5.44E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	2.37E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	6.86E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215354093	NA	1.37E-10	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251