| Variant ID: vg1215325180 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15325180 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATGATCTTTAGTCCCGATTGGTAATACCGACTGGGACTGAAGATCATAAGTGGCGTTGGGCTTTTCAACTGGGAAAAAAGGATGTTTAGTTCCAGTTCC[C/A]
ATTGAAACCGGGACTAATGTGATTTTTGACCGATCCACAAATGATCATTTCTCTGGTGTTGGTAGAAATGACACGAGGAGGTGCAACATATATATGCACA
TGTGCATATATATGTTGCACCTCCTCGTGTCATTTCTACCAACACCAGAGAAATGATCATTTGTGGATCGGTCAAAAATCACATTAGTCCCGGTTTCAAT[G/T]
GGAACTGGAACTAAACATCCTTTTTTCCCAGTTGAAAAGCCCAACGCCACTTATGATCTTCAGTCCCAGTCGGTATTACCAATCGGGACTAAAGATCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 13.50% | 0.99% | 0.55% | NA |
| All Indica | 2759 | 76.40% | 21.20% | 1.59% | 0.80% | NA |
| All Japonica | 1512 | 96.40% | 3.20% | 0.13% | 0.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 2.90% | 0.00% | 0.17% | NA |
| Indica II | 465 | 46.90% | 46.70% | 4.52% | 1.94% | NA |
| Indica III | 913 | 82.10% | 16.50% | 0.77% | 0.55% | NA |
| Indica Intermediate | 786 | 71.80% | 25.30% | 2.04% | 0.89% | NA |
| Temperate Japonica | 767 | 99.30% | 0.40% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 90.90% | 8.50% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215325180 | C -> DEL | N | N | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26270.1 | upstream_gene_variant ; 375.0bp to feature; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26280.1 | upstream_gene_variant ; 2313.0bp to feature; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26290.1 | downstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26290.2 | downstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26290.3 | downstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26290.4 | downstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26290.5 | downstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26290.6 | downstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1215325180 | C -> A | LOC_Os12g26270-LOC_Os12g26280 | intergenic_region ; MODIFIER | silent_mutation | Average:56.835; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215325180 | NA | 1.01E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215325180 | NA | 5.79E-06 | mr1030 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215325180 | NA | 1.57E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215325180 | NA | 1.82E-06 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215325180 | 2.75E-06 | 7.83E-06 | mr1579 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215325180 | NA | 6.75E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215325180 | NA | 6.37E-06 | mr1965 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215325180 | NA | 2.13E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |