Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214822906:

Variant ID: vg1214822906 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14822906
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCAGCGGCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCACAATCTCCACTCCGCGTAACCGAACCGGATAAGTCGTGCGTAACTGAT[C/T]
CGGACTCCACGCCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAACAACGAAACAAATCCAAATTTTCCTGCAGCAAAACAAAACTGCAAAAGAAGG

Reverse complement sequence

CCTTCTTTTGCAGTTTTGTTTTGCTGCAGGAAAATTTGGATTTGTTTCGTTGTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGCGTGGAGTCCG[G/A]
ATCAGTTACGCACGACTTATCCGGTTCGGTTACGCGGAGTGGAGATTGTGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGAGCCGCTGCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	25.60%	2.98%	6.83%	NA
All Indica	2759	47.80%	35.90%	4.89%	11.42%	NA
All Japonica	1512	86.80%	13.00%	0.20%	0.07%	NA
Aus	269	97.80%	1.50%	0.37%	0.37%	NA
Indica I	595	67.60%	21.80%	8.91%	1.68%	NA
Indica II	465	24.10%	71.80%	0.65%	3.44%	NA
Indica III	913	47.50%	26.10%	4.16%	22.23%	NA
Indica Intermediate	786	47.10%	36.80%	5.22%	10.94%	NA
Temperate Japonica	767	93.60%	6.30%	0.13%	0.00%	NA
Tropical Japonica	504	78.40%	21.40%	0.00%	0.20%	NA
Japonica Intermediate	241	82.60%	16.60%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	20.00%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214822906	C -> DEL	N	N	silent_mutation	Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41	N	N	N	N
vg1214822906	C -> T	LOC_Os12g25600.1	upstream_gene_variant ; 3109.0bp to feature; MODIFIER	silent_mutation	Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41	N	N	N	N
vg1214822906	C -> T	LOC_Os12g25630.1	downstream_gene_variant ; 4406.0bp to feature; MODIFIER	silent_mutation	Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41	N	N	N	N
vg1214822906	C -> T	LOC_Os12g25610.1	intron_variant ; MODIFIER	silent_mutation	Average:64.228; most accessible tissue: Zhenshan97 flag leaf, score: 81.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214822906	NA	1.76E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	5.66E-07	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	5.12E-07	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	7.58E-06	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	3.27E-06	mr1579	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	2.32E-06	1.39E-09	mr1889	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	1.58E-08	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	6.08E-06	6.08E-06	mr1487_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	5.38E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	1.08E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	9.76E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214822906	NA	8.43E-07	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251