| Variant ID: vg1214799094 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14799094 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )
TTGACATCGGAGATTATCTTGATGAGGCAGAAGAGGATATTTCAAGCAAAGCTCTAGCCCCCTTATCTGACGATGTGAAGAAAACAGTTGAAGATATCTC[C/T]
CGTTGGCTAGAGGCCTCTTCTTTAGATAGCTTGGTGGTCGACTGTGGATCGATTAGGACACGACTACATGAAGTTCAAGCTCTGATTCCCGAAGAACTAG
CTAGTTCTTCGGGAATCAGAGCTTGAACTTCATGTAGTCGTGTCCTAATCGATCCACAGTCGACCACCAAGCTATCTAAAGAAGAGGCCTCTAGCCAACG[G/A]
GAGATATCTTCAACTGTTTTCTTCACATCGTCAGATAAGGGGGCTAGAGCTTTGCTTGAAATATCCTCTTCTGCCTCATCAAGATAATCTCCGATGTCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.30% | 26.80% | 4.87% | 11.00% | NA |
| All Indica | 2759 | 83.80% | 6.80% | 5.69% | 3.73% | NA |
| All Japonica | 1512 | 4.50% | 67.90% | 1.46% | 26.19% | NA |
| Aus | 269 | 88.80% | 7.80% | 1.49% | 1.86% | NA |
| Indica I | 595 | 83.20% | 11.30% | 3.87% | 1.68% | NA |
| Indica II | 465 | 82.40% | 6.20% | 5.38% | 6.02% | NA |
| Indica III | 913 | 85.00% | 3.00% | 7.45% | 4.60% | NA |
| Indica Intermediate | 786 | 83.70% | 8.10% | 5.22% | 2.93% | NA |
| Temperate Japonica | 767 | 2.60% | 88.90% | 0.78% | 7.69% | NA |
| Tropical Japonica | 504 | 5.60% | 40.90% | 1.79% | 51.79% | NA |
| Japonica Intermediate | 241 | 8.30% | 57.30% | 2.90% | 31.54% | NA |
| VI/Aromatic | 96 | 37.50% | 2.10% | 47.92% | 12.50% | NA |
| Intermediate | 90 | 60.00% | 34.40% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214799094 | C -> DEL | LOC_Os12g25570.1 | N | frameshift_variant | Average:15.196; most accessible tissue: Callus, score: 22.083 | N | N | N | N |
| vg1214799094 | C -> T | LOC_Os12g25570.1 | synonymous_variant ; p.Ser564Ser; LOW | synonymous_codon | Average:15.196; most accessible tissue: Callus, score: 22.083 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214799094 | NA | 1.18E-28 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214799094 | 6.94E-06 | 4.69E-06 | mr1173 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214799094 | 9.08E-06 | 9.89E-06 | mr1268 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214799094 | 8.70E-06 | 8.70E-06 | mr1429 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214799094 | 7.38E-06 | 5.73E-06 | mr1549 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214799094 | 6.64E-06 | 6.64E-06 | mr1572 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214799094 | 4.87E-06 | 4.87E-06 | mr1954 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214799094 | NA | 7.28E-37 | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214799094 | NA | 7.52E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |