| Variant ID: vg1214485336 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 14485336 |
| Reference Allele: GA | Alternative Allele: AA,G |
| Primary Allele: GA | Secondary Allele: AA |
Inferred Ancestral Allele: Not determined.
ATTTTAGAATTTTTAAGAATTTCACTAATTTATTGGAGCATCACATGGCAACTTAGGAGCGTTTGTAGGATGTCATATGGCGAATTAGGAGCATTTTTGG[GA/AA,G]
AATTTAATGGACTTTTAGACATCTAATCTGATGTTCTAAAACATTAATCAGGTCCACCAATTTAAATGAAAATAGACGGTGATATTTATATAAATTTATA
TATAAATTTATATAAATATCACCGTCTATTTTCATTTAAATTGGTGGACCTGATTAATGTTTTAGAACATCAGATTAGATGTCTAAAAGTCCATTAAATT[TC/TT,C]
CCAAAAATGCTCCTAATTCGCCATATGACATCCTACAAACGCTCCTAAGTTGCCATGTGATGCTCCAATAAATTAGTGAAATTCTTAAAAATTCTAAAAT
| Populations | Population Size | Frequency of GA(primary allele) | Frequency of AA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 2.30% | 2.79% | 4.34% | NA |
| All Indica | 2759 | 85.30% | 3.80% | 4.42% | 6.49% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.00% | 0.07% | NA |
| Aus | 269 | 86.60% | 1.10% | 2.97% | 9.29% | NA |
| Indica I | 595 | 61.80% | 10.10% | 11.76% | 16.30% | NA |
| Indica II | 465 | 94.20% | 2.20% | 2.15% | 1.51% | NA |
| Indica III | 913 | 95.30% | 1.00% | 0.66% | 3.07% | NA |
| Indica Intermediate | 786 | 86.10% | 3.30% | 4.58% | 5.98% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214485336 | GA -> DEL | N | N | silent_mutation | Average:37.915; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg1214485336 | GA -> G | LOC_Os12g25200.1 | downstream_gene_variant ; 2059.0bp to feature; MODIFIER | N | Average:37.915; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg1214485336 | GA -> G | LOC_Os12g25190-LOC_Os12g25200 | intergenic_region ; MODIFIER | N | Average:37.915; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg1214485336 | GA -> AA | LOC_Os12g25200.1 | downstream_gene_variant ; 2060.0bp to feature; MODIFIER | silent_mutation | Average:37.915; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| vg1214485336 | GA -> AA | LOC_Os12g25190-LOC_Os12g25200 | intergenic_region ; MODIFIER | silent_mutation | Average:37.915; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214485336 | NA | 3.17E-06 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 3.14E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | 9.15E-06 | 1.35E-08 | mr1164_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 4.83E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 1.78E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 1.33E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 9.89E-06 | mr1266_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 5.73E-07 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 6.14E-06 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 1.59E-12 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 4.88E-07 | mr1521_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214485336 | NA | 1.14E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |