Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214331785:

Variant ID: vg1214331785 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14331785
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAGTCTCCTAATGTTTATTATAACCTAAAGAACCATGTGCTTTCGTTTTATGTATTGTTATTGCTTCTTTATAGGCTTGTAGCTTTGCTTGTGTGCTT[C/T]
GCGTAGCTTCTGTCGTTCCGAAGGTTCTCGCAGCGTGGTTTGCGGTCGTCGCCGAAGGTTCGGAAGGCCGTTCTCTCTGAGCAAGGCAAGTCACATCATC

Reverse complement sequence

GATGATGTGACTTGCCTTGCTCAGAGAGAACGGCCTTCCGAACCTTCGGCGACGACCGCAAACCACGCTGCGAGAACCTTCGGAACGACAGAAGCTACGC[G/A]
AAGCACACAAGCAAAGCTACAAGCCTATAAAGAAGCAATAACAATACATAAAACGAAAGCACATGGTTCTTTAGGTTATAATAAACATTAGGAGACTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.60%	12.40%	31.57%	14.37%	NA
All Indica	2759	29.20%	3.60%	46.79%	20.41%	NA
All Japonica	1512	69.40%	27.20%	0.40%	2.98%	NA
Aus	269	20.40%	17.80%	56.88%	4.83%	NA
Indica I	595	40.80%	0.30%	35.46%	23.36%	NA
Indica II	465	24.30%	12.00%	37.42%	26.24%	NA
Indica III	913	23.00%	2.00%	60.57%	14.46%	NA
Indica Intermediate	786	30.50%	2.90%	44.91%	21.63%	NA
Temperate Japonica	767	85.00%	9.80%	0.13%	5.08%	NA
Tropical Japonica	504	44.20%	55.20%	0.60%	0.00%	NA
Japonica Intermediate	241	72.20%	24.50%	0.83%	2.49%	NA
VI/Aromatic	96	5.20%	14.60%	25.00%	55.21%	NA
Intermediate	90	58.90%	15.60%	20.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214331785	C -> DEL	N	N	silent_mutation	Average:20.864; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1214331785	C -> T	LOC_Os12g24960.1	upstream_gene_variant ; 926.0bp to feature; MODIFIER	silent_mutation	Average:20.864; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1214331785	C -> T	LOC_Os12g24950.1	downstream_gene_variant ; 4174.0bp to feature; MODIFIER	silent_mutation	Average:20.864; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1214331785	C -> T	LOC_Os12g24970.1	downstream_gene_variant ; 2016.0bp to feature; MODIFIER	silent_mutation	Average:20.864; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1214331785	C -> T	LOC_Os12g24980.1	downstream_gene_variant ; 4989.0bp to feature; MODIFIER	silent_mutation	Average:20.864; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1214331785	C -> T	LOC_Os12g24960-LOC_Os12g24970	intergenic_region ; MODIFIER	silent_mutation	Average:20.864; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214331785	NA	4.74E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331785	NA	2.50E-07	mr1606	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251