Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214331148:

Variant ID: vg1214331148 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14331148
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTCGTCGTCTTCGTCCTCGGCTCCGCGTCGTCAAGCCTCGTGCCGGCCGTGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTT[C/T]
GCCTCCGTCTTCCCCGAGCCGTGTCCGCCGTGCCTGTTCGTCATCATCGTTCCCACGCCTCGTCGCGTGGTGGTAAGGATCCCTCTCCCTCGCTGCCCCG

Reverse complement sequence

CGGGGCAGCGAGGGAGAGGGATCCTTACCACCACGCGACGAGGCGTGGGAACGATGATGACGAACAGGCACGGCGGACACGGCTCGGGGAAGACGGAGGC[G/A]
AACGGCGAGGGAACGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACACGGCCGGCACGAGGCTTGACGACGCGGAGCCGAGGACGAAGACGACGACGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	23.20%	0.30%	1.25%	NA
All Indica	2759	88.10%	10.60%	0.40%	0.91%	NA
All Japonica	1512	51.10%	46.60%	0.20%	2.05%	NA
Aus	269	79.60%	20.10%	0.00%	0.37%	NA
Indica I	595	92.80%	6.40%	0.50%	0.34%	NA
Indica II	465	84.10%	14.40%	0.22%	1.29%	NA
Indica III	913	88.00%	11.20%	0.11%	0.77%	NA
Indica Intermediate	786	87.20%	10.80%	0.76%	1.27%	NA
Temperate Japonica	767	80.20%	15.60%	0.39%	3.78%	NA
Tropical Japonica	504	13.70%	86.10%	0.00%	0.20%	NA
Japonica Intermediate	241	36.90%	62.70%	0.00%	0.41%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	60.00%	37.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214331148	C -> DEL	N	N	silent_mutation	Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1214331148	C -> T	LOC_Os12g24960.1	upstream_gene_variant ; 289.0bp to feature; MODIFIER	silent_mutation	Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1214331148	C -> T	LOC_Os12g24950.1	downstream_gene_variant ; 3537.0bp to feature; MODIFIER	silent_mutation	Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1214331148	C -> T	LOC_Os12g24970.1	downstream_gene_variant ; 2653.0bp to feature; MODIFIER	silent_mutation	Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1214331148	C -> T	LOC_Os12g24960-LOC_Os12g24970	intergenic_region ; MODIFIER	silent_mutation	Average:30.333; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214331148	4.84E-06	1.54E-06	mr1339	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148	NA	8.55E-09	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148	NA	1.12E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148	8.18E-06	8.18E-06	mr1499	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148	NA	2.83E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214331148	2.62E-06	2.62E-06	mr1881	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251