Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214325834:

Variant ID: vg1214325834 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14325834
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CACTATAATATGCAAAACCGATGTGGTTAAGTACATGTTATCGGCTCCAATTTTGAAAGGGAGAGTTGGAAAGTGGATATTTTCTTTAACTAAATTTGAT[C/G]
TTCGGTATGAGTCATCGAAGGCAATCAAGGGATAGGCTATAGCTGATTTTATTGTTAATCATCGTGATGATTCAATCGGCTCGATTAAGGTTGTTCCCTG

Reverse complement sequence

CAGGGAACAACCTTAATCGAGCCGATTGAATCATCACGATGATTAACAATAAAATCAGCTATAGCCTATCCCTTGATTGCCTTCGATGACTCATACCGAA[G/C]
ATCAAATTTAGTTAAAGAAAATATCCACTTTCCAACTCTCCCTTTCAAAATTGGAGCCGATAACATGTACTTAACCACATCGGTTTTGCATATTATAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.70% 12.30% 1.12% 52.86% NA
All Indica  2759 17.50% 3.50% 1.74% 77.27% NA
All Japonica  1512 69.60% 27.20% 0.07% 3.11% NA
Aus  269 3.30% 17.80% 0.37% 78.44% NA
Indica I  595 15.30% 0.20% 1.51% 83.03% NA
Indica II  465 17.20% 12.00% 1.94% 68.82% NA
Indica III  913 15.20% 1.90% 1.10% 81.82% NA
Indica Intermediate  786 21.90% 2.90% 2.54% 72.65% NA
Temperate Japonica  767 85.70% 9.80% 0.13% 4.43% NA
Tropical Japonica  504 44.00% 54.80% 0.00% 1.19% NA
Japonica Intermediate  241 72.20% 24.90% 0.00% 2.90% NA
VI/Aromatic  96 5.20% 14.60% 3.12% 77.08% NA
Intermediate  90 47.80% 14.40% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214325834 C -> DEL N N silent_mutation Average:22.46; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1214325834 C -> G LOC_Os12g24940.1 upstream_gene_variant ; 1583.0bp to feature; MODIFIER silent_mutation Average:22.46; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1214325834 C -> G LOC_Os12g24960.1 downstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:22.46; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1214325834 C -> G LOC_Os12g24950.1 intron_variant ; MODIFIER silent_mutation Average:22.46; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214325834 NA 1.16E-20 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.67E-14 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 5.04E-20 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.60E-13 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 5.80E-19 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 9.58E-21 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 3.17E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.13E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.44E-08 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 5.73E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 2.18E-14 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 7.19E-15 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 4.88E-18 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.76E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 7.05E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 4.80E-06 2.46E-06 mr1304 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 4.35E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 6.76E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 4.97E-19 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 7.68E-09 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 9.16E-12 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 3.84E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 3.63E-09 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 2.98E-18 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.10E-13 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 3.71E-14 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 6.59E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 6.50E-07 6.49E-07 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 9.32E-07 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 9.76E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 8.53E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 7.12E-08 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.34E-21 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.35E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.60E-20 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 7.94E-21 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.65E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 2.56E-10 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 5.40E-16 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.20E-21 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 3.91E-07 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.36E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 2.31E-08 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.27E-09 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 6.81E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 6.43E-22 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.70E-16 mr1410_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.13E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 3.70E-20 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 4.82E-12 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.59E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 2.84E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 6.69E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 3.35E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 2.17E-09 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214325834 NA 1.12E-07 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251