Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214243584:

Variant ID: vg1214243584 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14243584
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAAAGCAAGAACTTGTCGAAACAAAACTAAAGCAAAAGAGTAGCGATGCACCAAAGTTGCATTGAACGTGTGTGTTGTTAATTACATAGGGCTCGGGGT[C/T]
TATTTATACCCTGGAATTACAAGACATGCCCACACCAGACACGACTATTATCTCTAACAAACTCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCC

Reverse complement sequence

GGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAATAGTCGTGTCTGGTGTGGGCATGTCTTGTAATTCCAGGGTATAAATA[G/A]
ACCCCGAGCCCTATGTAATTAACAACACACACGTTCAATGCAACTTTGGTGCATCGCTACTCTTTTGCTTTAGTTTTGTTTCGACAAGTTCTTGCTTTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	3.90%	2.62%	6.88%	NA
All Indica	2759	85.10%	0.50%	3.01%	11.42%	NA
All Japonica	1512	86.20%	10.90%	2.45%	0.40%	NA
Aus	269	97.80%	1.90%	0.37%	0.00%	NA
Indica I	595	56.50%	0.30%	8.07%	35.13%	NA
Indica II	465	96.10%	0.00%	1.29%	2.58%	NA
Indica III	913	96.70%	0.40%	0.88%	1.97%	NA
Indica Intermediate	786	86.80%	0.90%	2.67%	9.67%	NA
Temperate Japonica	767	95.70%	2.90%	1.30%	0.13%	NA
Tropical Japonica	504	78.80%	18.50%	2.18%	0.60%	NA
Japonica Intermediate	241	71.80%	20.70%	6.64%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	3.30%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214243584	C -> DEL	N	N	silent_mutation	Average:20.229; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg1214243584	C -> T	LOC_Os12g24820.1	upstream_gene_variant ; 668.0bp to feature; MODIFIER	silent_mutation	Average:20.229; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg1214243584	C -> T	LOC_Os12g24810.1	downstream_gene_variant ; 1062.0bp to feature; MODIFIER	silent_mutation	Average:20.229; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg1214243584	C -> T	LOC_Os12g24830.1	downstream_gene_variant ; 4232.0bp to feature; MODIFIER	silent_mutation	Average:20.229; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg1214243584	C -> T	LOC_Os12g24810-LOC_Os12g24820	intergenic_region ; MODIFIER	silent_mutation	Average:20.229; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214243584	NA	3.67E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214243584	NA	4.99E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214243584	NA	1.55E-09	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214243584	NA	1.74E-09	mr1236	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214243584	NA	4.50E-08	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214243584	NA	5.88E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214243584	NA	2.66E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251