Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214093173:

Variant ID: vg1214093173 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14093173
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GGGACTAAAGATCAATCTTGAGTCCCGGTTGGAGTTATCAACCGGGAGTAAATATTTCTCTCCCACATCCGATCGGTTAAGTCCCAGACAGATATTTAGA[T/C]
AAGATTGAAACATCCCCTCTCTTCCTCTTCTCAGATCCAATCCTCTTCCTCCTCCCCTCCCCTCTCTTCCTCCCCTCCTCCCCTTCCTCTTCTCCTCCCC

Reverse complement sequence

GGGGAGGAGAAGAGGAAGGGGAGGAGGGGAGGAAGAGAGGGGAGGGGAGGAGGAAGAGGATTGGATCTGAGAAGAGGAAGAGAGGGGATGTTTCAATCTT[A/G]
TCTAAATATCTGTCTGGGACTTAACCGATCGGATGTGGGAGAGAAATATTTACTCCCGGTTGATAACTCCAACCGGGACTCAAGATTGATCTTTAGTCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	24.80%	0.23%	0.00%	NA
All Indica	2759	58.40%	41.30%	0.36%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	44.90%	55.10%	0.00%	0.00%	NA
Indica II	465	75.90%	23.90%	0.22%	0.00%	NA
Indica III	913	53.00%	46.40%	0.55%	0.00%	NA
Indica Intermediate	786	64.40%	35.10%	0.51%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214093173	T -> C	LOC_Os12g24620.1	upstream_gene_variant ; 444.0bp to feature; MODIFIER	silent_mutation	Average:35.12; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg1214093173	T -> C	LOC_Os12g24630.1	downstream_gene_variant ; 3795.0bp to feature; MODIFIER	silent_mutation	Average:35.12; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg1214093173	T -> C	LOC_Os12g24620-LOC_Os12g24630	intergenic_region ; MODIFIER	silent_mutation	Average:35.12; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214093173	NA	5.39E-06	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214093173	2.18E-06	2.18E-06	mr1853	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214093173	NA	1.53E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214093173	NA	1.17E-07	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214093173	4.73E-06	4.73E-06	mr1853_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251