Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214091707:

Variant ID: vg1214091707 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14091707
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CTCATTCAATGCACAAATTGCTTTTTTCTAGGACAAATGCTCCATCCAGAAATCGATTCTTTCTGAAACGAAGGGAAACGAAGGGAGTATATATTTATAG[G/A]
TAAATATTATATAATTCTATTAAATTGACTTTAAATTATTTAAAGCTAATAGTTAGCTATACTATTAAACTTCTCTAAGTAGGTAAATCCCTTTGGCCAC

Reverse complement sequence

GTGGCCAAAGGGATTTACCTACTTAGAGAAGTTTAATAGTATAGCTAACTATTAGCTTTAAATAATTTAAAGTCAATTTAATAGAATTATATAATATTTA[C/T]
CTATAAATATATACTCCCTTCGTTTCCCTTCGTTTCAGAAAGAATCGATTTCTGGATGGAGCATTTGTCCTAGAAAAAAGCAATTTGTGCATTGAATGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 3.60% 0.99% 0.00% NA
All Indica  2759 97.90% 1.80% 0.25% 0.00% NA
All Japonica  1512 89.70% 7.60% 2.65% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.10% 0.65% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 1.80% 0.51% 0.00% NA
Temperate Japonica  767 88.10% 7.00% 4.82% 0.00% NA
Tropical Japonica  504 89.90% 10.10% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 4.10% 1.24% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214091707 G -> A LOC_Os12g24620.1 downstream_gene_variant ; 597.0bp to feature; MODIFIER silent_mutation Average:80.748; most accessible tissue: Minghui63 panicle, score: 94.638 N N N N
vg1214091707 G -> A LOC_Os12g24610-LOC_Os12g24620 intergenic_region ; MODIFIER silent_mutation Average:80.748; most accessible tissue: Minghui63 panicle, score: 94.638 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1214091707 G A 0.0 0.0 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214091707 7.22E-06 7.22E-06 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 7.51E-06 7.51E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 NA 5.66E-06 mr1148_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 NA 9.56E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 NA 3.10E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 NA 4.80E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 8.96E-06 8.95E-06 mr1302_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 NA 6.77E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 NA 3.94E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 NA 8.11E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 4.31E-06 4.31E-06 mr1440_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 1.46E-06 1.46E-06 mr1455_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214091707 NA 4.61E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251