Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213729703:

Variant ID: vg1213729703 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13729703
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

TCAACTAATTACTCTGAAATTACCTCAAACAAATTCAGTAGCAGCAACGTCGTCGAGGCAGAGAGGTGGACGAAGGGGCAGAGATTGGTGACAGTGCTGC[C/T]
GCCGATGGCCCCAGCGGTGACCTGGACGGACGACCGACGGTGCCCTGGATCAACGGACGGTGGCACCCTGGACAGAGGACTGGCAGCTACCTGAATGGTG

Reverse complement sequence

CACCATTCAGGTAGCTGCCAGTCCTCTGTCCAGGGTGCCACCGTCCGTTGATCCAGGGCACCGTCGGTCGTCCGTCCAGGTCACCGCTGGGGCCATCGGC[G/A]
GCAGCACTGTCACCAATCTCTGCCCCTTCGTCCACCTCTCTGCCTCGACGACGTTGCTGCTACTGAATTTGTTTGAGGTAATTTCAGAGTAATTAGTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.80%	36.40%	0.34%	12.55%	NA
All Indica	2759	53.20%	26.30%	0.43%	20.08%	NA
All Japonica	1512	56.30%	41.20%	0.07%	2.38%	NA
Aus	269	3.70%	95.90%	0.37%	0.00%	NA
Indica I	595	50.10%	47.90%	0.34%	1.68%	NA
Indica II	465	31.80%	24.50%	0.43%	43.23%	NA
Indica III	913	65.40%	15.70%	0.55%	18.40%	NA
Indica Intermediate	786	54.10%	23.30%	0.38%	22.26%	NA
Temperate Japonica	767	83.30%	12.30%	0.00%	4.43%	NA
Tropical Japonica	504	15.90%	83.90%	0.20%	0.00%	NA
Japonica Intermediate	241	55.20%	44.00%	0.00%	0.83%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	56.70%	37.80%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213729703	C -> DEL	N	N	silent_mutation	Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg1213729703	C -> T	LOC_Os12g24120.1	downstream_gene_variant ; 3278.0bp to feature; MODIFIER	silent_mutation	Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg1213729703	C -> T	LOC_Os12g24120-LOC_Os12g24130	intergenic_region ; MODIFIER	silent_mutation	Average:68.764; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213729703	NA	4.50E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	4.12E-06	mr1460	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	3.26E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	2.42E-06	mr1639	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	7.82E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	1.24E-11	mr1706	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	2.03E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	2.50E-06	mr1164_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	6.70E-07	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	3.40E-06	mr1578_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213729703	NA	2.52E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251