Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213653651:

Variant ID: vg1213653651 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13653651
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCTCCATTATCACAAAACTACAGGTTAAAACCTGTGATAATGAAAACACTAAACCTGTAGCTTTGTGATAAATGAAAATATTAAATCTGCAGTTTTGT[G/A]
AAACAAGTTCTTAAATCTGTAGTTTTGTGATATATTGTGCATAATACTTGTAGTTCTGTGATAAACGAAGATATTAAATCTGTAGTTTTGTGAAATAAGT

Reverse complement sequence

ACTTATTTCACAAAACTACAGATTTAATATCTTCGTTTATCACAGAACTACAAGTATTATGCACAATATATCACAAAACTACAGATTTAAGAACTTGTTT[C/T]
ACAAAACTGCAGATTTAATATTTTCATTTATCACAAAGCTACAGGTTTAGTGTTTTCATTATCACAGGTTTTAACCTGTAGTTTTGTGATAATGGAGACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	14.00%	1.04%	0.00%	NA
All Indica	2759	79.20%	20.20%	0.69%	0.00%	NA
All Japonica	1512	91.70%	6.40%	1.92%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.00%	1.70%	1.34%	0.00%	NA
Indica II	465	53.10%	46.20%	0.65%	0.00%	NA
Indica III	913	82.00%	17.50%	0.44%	0.00%	NA
Indica Intermediate	786	77.70%	21.80%	0.51%	0.00%	NA
Temperate Japonica	767	92.20%	6.80%	1.04%	0.00%	NA
Tropical Japonica	504	91.70%	6.30%	1.98%	0.00%	NA
Japonica Intermediate	241	90.00%	5.40%	4.56%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213653651	G -> A	LOC_Os12g24020.1	upstream_gene_variant ; 3448.0bp to feature; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1213653651	G -> A	LOC_Os12g24020.2	upstream_gene_variant ; 3448.0bp to feature; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1213653651	G -> A	LOC_Os12g24020.3	upstream_gene_variant ; 3449.0bp to feature; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1213653651	G -> A	LOC_Os12g24010-LOC_Os12g24020	intergenic_region ; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213653651	NA	2.31E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	2.74E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	6.08E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	1.84E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	6.45E-07	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	6.29E-06	NA	mr1319	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	7.67E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	6.01E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	1.77E-06	1.77E-06	mr1674	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	7.18E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	1.76E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213653651	NA	1.93E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251