Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213499508:

Variant ID: vg1213499508 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13499508
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTGCCGGTCACTTTCTATCCTTGCCCTCTACCCCCGGCAATTGTCAGGGCCCCGGCCCGTCCGCCTAGCGGGTGAGGAATTAGCCCCACCATCAGCCC[C/T]
GTAGGGGTGGGTTACCTGTGTGGTCCTCGCCCCAATTGCCACTCCTACTTATATGGAAGAGGGTGAACAAGATTTTGGTGAAAAACCGTACTCGATTTGT

Reverse complement sequence

ACAAATCGAGTACGGTTTTTCACCAAAATCTTGTTCACCCTCTTCCATATAAGTAGGAGTGGCAATTGGGGCGAGGACCACACAGGTAACCCACCCCTAC[G/A]
GGGCTGATGGTGGGGCTAATTCCTCACCCGCTAGGCGGACGGGCCGGGGCCCTGACAATTGCCGGGGGTAGAGGGCAAGGATAGAAAGTGACCGGCAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 14.30% 1.23% 21.03% NA
All Indica  2759 43.70% 20.70% 0.91% 34.72% NA
All Japonica  1512 90.60% 6.60% 1.98% 0.79% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 59.00% 1.80% 1.01% 38.15% NA
Indica II  465 30.50% 47.30% 0.22% 21.94% NA
Indica III  913 37.70% 17.90% 0.88% 43.59% NA
Indica Intermediate  786 46.90% 22.40% 1.27% 29.39% NA
Temperate Japonica  767 91.30% 6.80% 0.91% 1.04% NA
Tropical Japonica  504 90.50% 6.30% 2.38% 0.79% NA
Japonica Intermediate  241 88.80% 6.60% 4.56% 0.00% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 80.00% 6.70% 3.33% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213499508 C -> DEL N N silent_mutation Average:85.026; most accessible tissue: Callus, score: 99.278 N N N N
vg1213499508 C -> T LOC_Os12g23770.1 upstream_gene_variant ; 1636.0bp to feature; MODIFIER silent_mutation Average:85.026; most accessible tissue: Callus, score: 99.278 N N N N
vg1213499508 C -> T LOC_Os12g23760.1 downstream_gene_variant ; 230.0bp to feature; MODIFIER silent_mutation Average:85.026; most accessible tissue: Callus, score: 99.278 N N N N
vg1213499508 C -> T LOC_Os12g23760-LOC_Os12g23770 intergenic_region ; MODIFIER silent_mutation Average:85.026; most accessible tissue: Callus, score: 99.278 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1213499508 C T 0.02 0.02 0.02 0.03 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213499508 NA 1.88E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213499508 NA 3.36E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213499508 NA 1.13E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213499508 NA 2.93E-06 mr1311 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213499508 3.56E-06 NA mr1319 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213499508 NA 2.30E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213499508 3.15E-07 3.14E-07 mr1674 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213499508 NA 1.02E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251