| Variant ID: vg1213186520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13186520 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGCGAGATAAATCTTTTAAGCCTAATTGTGCCATTTTTTGACAATGTGGTACTACAGTAAACATTTGCTAATAATGGATTAATTAGGATTAATAAATTC[G/A]
TCTCGCAGTTTCCTAGCGGAATCTATAATTTGTTTTGTTATTAGACAACGTTTAATACTTCAAATGTGTGTCCATATATCCGATGTGACACCCCAAAACA
TGTTTTGGGGTGTCACATCGGATATATGGACACACATTTGAAGTATTAAACGTTGTCTAATAACAAAACAAATTATAGATTCCGCTAGGAAACTGCGAGA[C/T]
GAATTTATTAATCCTAATTAATCCATTATTAGCAAATGTTTACTGTAGTACCACATTGTCAAAAAATGGCACAATTAGGCTTAAAAGATTTATCTCGCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 5.10% | 16.21% | 29.03% | NA |
| All Indica | 2759 | 45.50% | 1.50% | 20.59% | 32.48% | NA |
| All Japonica | 1512 | 58.10% | 7.30% | 8.20% | 26.32% | NA |
| Aus | 269 | 43.10% | 26.00% | 18.22% | 12.64% | NA |
| Indica I | 595 | 19.50% | 0.00% | 30.42% | 50.08% | NA |
| Indica II | 465 | 62.60% | 0.20% | 12.90% | 24.30% | NA |
| Indica III | 913 | 54.90% | 2.60% | 18.07% | 24.42% | NA |
| Indica Intermediate | 786 | 44.00% | 2.00% | 20.61% | 33.33% | NA |
| Temperate Japonica | 767 | 83.40% | 0.50% | 1.56% | 14.47% | NA |
| Tropical Japonica | 504 | 29.00% | 20.60% | 17.66% | 32.74% | NA |
| Japonica Intermediate | 241 | 38.60% | 1.20% | 9.54% | 50.62% | NA |
| VI/Aromatic | 96 | 55.20% | 8.30% | 15.62% | 20.83% | NA |
| Intermediate | 90 | 52.20% | 10.00% | 11.11% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213186520 | G -> DEL | N | N | silent_mutation | Average:17.88; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1213186520 | G -> A | LOC_Os12g23280-LOC_Os12g23300 | intergenic_region ; MODIFIER | silent_mutation | Average:17.88; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213186520 | 5.29E-07 | NA | mr1016 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | 1.08E-06 | NA | mr1017 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | 4.06E-06 | NA | mr1019 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | 9.12E-09 | NA | mr1055 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | 3.53E-06 | NA | mr1390 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | 9.21E-06 | NA | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | NA | 2.29E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | 1.49E-06 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | 1.54E-08 | NA | mr1055_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213186520 | 1.13E-08 | NA | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/