Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213091376:

Variant ID: vg1213091376 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13091376
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTATTCATCATGACATTTACGTGATCTATTAATTGATGCGATTGAAATTCCCAAAATAAACCGATTTACATGGGAATAGCTGGTGATATCAAACCTT[G/A]
AAATTCCCAAAATAAACCGATTTATTTGGGAATAGCTGGTGATATCAAACCTTGAAATTCCCAAAATAAACCGATTTACTTGGCAATAGCTGGTGATATC

Reverse complement sequence

GATATCACCAGCTATTGCCAAGTAAATCGGTTTATTTTGGGAATTTCAAGGTTTGATATCACCAGCTATTCCCAAATAAATCGGTTTATTTTGGGAATTT[C/T]
AAGGTTTGATATCACCAGCTATTCCCATGTAAATCGGTTTATTTTGGGAATTTCAATCGCATCAATTAATAGATCACGTAAATGTCATGATGAATAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	5.00%	1.25%	11.96%	NA
All Indica	2759	70.60%	8.40%	2.10%	18.88%	NA
All Japonica	1512	97.20%	0.10%	0.00%	2.71%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	75.80%	21.00%	1.85%	1.34%	NA
Indica II	465	51.00%	2.80%	3.44%	42.80%	NA
Indica III	913	76.50%	4.20%	1.64%	17.74%	NA
Indica Intermediate	786	71.50%	7.10%	2.04%	19.34%	NA
Temperate Japonica	767	95.00%	0.10%	0.00%	4.82%	NA
Tropical Japonica	504	99.40%	0.20%	0.00%	0.40%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	2.20%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213091376	G -> DEL	N	N	silent_mutation	Average:57.995; most accessible tissue: Minghui63 root, score: 78.833	N	N	N	N
vg1213091376	G -> A	LOC_Os12g23140.1	upstream_gene_variant ; 4818.0bp to feature; MODIFIER	silent_mutation	Average:57.995; most accessible tissue: Minghui63 root, score: 78.833	N	N	N	N
vg1213091376	G -> A	LOC_Os12g23150.1	downstream_gene_variant ; 4041.0bp to feature; MODIFIER	silent_mutation	Average:57.995; most accessible tissue: Minghui63 root, score: 78.833	N	N	N	N
vg1213091376	G -> A	LOC_Os12g23140-LOC_Os12g23150	intergenic_region ; MODIFIER	silent_mutation	Average:57.995; most accessible tissue: Minghui63 root, score: 78.833	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213091376	NA	7.05E-08	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213091376	1.20E-06	NA	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213091376	5.32E-07	2.31E-09	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213091376	6.83E-06	4.68E-09	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213091376	5.18E-06	5.18E-06	mr1529_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213091376	9.31E-06	NA	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213091376	3.64E-06	NA	mr1566_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213091376	NA	4.04E-08	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251