| Variant ID: vg1213038870 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 13038870 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACCACTGTTGGTCTCCATGCCGAGGAGGTTGTCCCTTTAGGACGCTGGGGTGCGGTCTGAGGCGGGCGGTTCATGGCAAGCCTCCTTTTACGATTGTGCT[C/G]
CACGACCTTCCGGTCGTTTTCCAGCCTAACGACCTTATTGATTAAACTCTGGAAACTATCGTGGTCTTGTCTAATCATGGGCCCACGCAACTCGTCATTC
GAATGACGAGTTGCGTGGGCCCATGATTAGACAAGACCACGATAGTTTCCAGAGTTTAATCAATAAGGTCGTTAGGCTGGAAAACGACCGGAAGGTCGTG[G/C]
AGCACAATCGTAAAAGGAGGCTTGCCATGAACCGCCCGCCTCAGACCGCACCCCAGCGTCCTAAAGGGACAACCTCCTCGGCATGGAGACCAACAGTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.20% | 10.40% | 3.75% | 51.67% | NA |
| All Indica | 2759 | 29.60% | 11.70% | 5.18% | 53.43% | NA |
| All Japonica | 1512 | 44.80% | 0.20% | 0.40% | 54.63% | NA |
| Aus | 269 | 4.80% | 56.50% | 5.20% | 33.46% | NA |
| Indica I | 595 | 14.30% | 1.30% | 4.54% | 79.83% | NA |
| Indica II | 465 | 16.30% | 29.20% | 8.39% | 46.02% | NA |
| Indica III | 913 | 45.80% | 8.90% | 3.50% | 41.84% | NA |
| Indica Intermediate | 786 | 30.40% | 12.60% | 5.73% | 51.27% | NA |
| Temperate Japonica | 767 | 78.40% | 0.00% | 0.26% | 21.38% | NA |
| Tropical Japonica | 504 | 3.20% | 0.40% | 0.40% | 96.03% | NA |
| Japonica Intermediate | 241 | 24.90% | 0.40% | 0.83% | 73.86% | NA |
| VI/Aromatic | 96 | 68.80% | 5.20% | 10.42% | 15.62% | NA |
| Intermediate | 90 | 46.70% | 7.80% | 4.44% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1213038870 | C -> DEL | N | N | silent_mutation | Average:9.791; most accessible tissue: Callus, score: 22.249 | N | N | N | N |
| vg1213038870 | C -> G | LOC_Os12g23060.1 | upstream_gene_variant ; 83.0bp to feature; MODIFIER | silent_mutation | Average:9.791; most accessible tissue: Callus, score: 22.249 | N | N | N | N |
| vg1213038870 | C -> G | LOC_Os12g23070.1 | downstream_gene_variant ; 603.0bp to feature; MODIFIER | silent_mutation | Average:9.791; most accessible tissue: Callus, score: 22.249 | N | N | N | N |
| vg1213038870 | C -> G | LOC_Os12g23080.1 | downstream_gene_variant ; 2698.0bp to feature; MODIFIER | silent_mutation | Average:9.791; most accessible tissue: Callus, score: 22.249 | N | N | N | N |
| vg1213038870 | C -> G | LOC_Os12g23060-LOC_Os12g23070 | intergenic_region ; MODIFIER | silent_mutation | Average:9.791; most accessible tissue: Callus, score: 22.249 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1213038870 | 4.59E-06 | 1.69E-09 | mr1062 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213038870 | NA | 8.70E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1213038870 | NA | 1.11E-11 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |