Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212132495:

Variant ID: vg1212132495 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 12132495
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AACCAAATGAATAGTACAATTAAAGTTCATAAATGGGTAGATCTTGTATTTAGATGAATTATGAGACTTGAACGACCTCATTCCGAGTTCGAACGAATTA[T/G]
TTATGAATTTTACAAGAATTAATTTCAATTAAACCTATTAAAGAAAGAACTATTCCAAATTGTTTAAACAATTTACAAATGATTTATAGCTGAGACAAAA

Reverse complement sequence

TTTTGTCTCAGCTATAAATCATTTGTAAATTGTTTAAACAATTTGGAATAGTTCTTTCTTTAATAGGTTTAATTGAAATTAATTCTTGTAAAATTCATAA[A/C]
TAATTCGTTCGAACTCGGAATGAGGTCGTTCAAGTCTCATAATTCATCTAAATACAAGATCTACCCATTTATGAACTTTAATTGTACTATTCATTTGGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	0.60%	6.52%	2.16%	NA
All Indica	2759	84.40%	0.90%	11.09%	3.59%	NA
All Japonica	1512	99.80%	0.00%	0.00%	0.20%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.20%	0.67%	0.34%	NA
Indica II	465	76.10%	0.60%	14.62%	8.60%	NA
Indica III	913	80.10%	1.20%	15.99%	2.74%	NA
Indica Intermediate	786	83.30%	1.40%	11.20%	4.07%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1212132495	T -> DEL	N	N	silent_mutation	Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086	N	N	N	N
vg1212132495	T -> G	LOC_Os12g21590.1	upstream_gene_variant ; 580.0bp to feature; MODIFIER	silent_mutation	Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086	N	N	N	N
vg1212132495	T -> G	LOC_Os12g21570.1	downstream_gene_variant ; 3782.0bp to feature; MODIFIER	silent_mutation	Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086	N	N	N	N
vg1212132495	T -> G	LOC_Os12g21580.1	downstream_gene_variant ; 1523.0bp to feature; MODIFIER	silent_mutation	Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086	N	N	N	N
vg1212132495	T -> G	LOC_Os12g21580-LOC_Os12g21590	intergenic_region ; MODIFIER	silent_mutation	Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1212132495	6.69E-06	9.89E-08	mr1157	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212132495	NA	5.70E-07	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212132495	NA	1.43E-06	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212132495	NA	3.68E-07	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251