| Variant ID: vg1211781305 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 11781305 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAACCGCAACCCTTGAGAAACTAGTTCCTCATCTTGGAACCCTCGAAACCACCAGGAGTCAACTGCACGAGGCCAGAGAACTTGCCAGAAAGAATGAACA[C/T]
GATTTGAGGGATTGGATTGCTGAGCTCCAGGAATCCAATTATAAACTGAGTGGCTCATCCAAAGGTTCGCGCAAACTCTGCCCAACTGATTTGGGCTGTT
AACAGCCCAAATCAGTTGGGCAGAGTTTGCGCGAACCTTTGGATGAGCCACTCAGTTTATAATTGGATTCCTGGAGCTCAGCAATCCAATCCCTCAAATC[G/A]
TGTTCATTCTTTCTGGCAAGTTCTCTGGCCTCGTGCAGTTGACTCCTGGTGGTTTCGAGGGTTCCAAGATGAGGAACTAGTTTCTCAAGGGTTGCGGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.30% | 1.50% | 6.12% | 11.07% | NA |
| All Indica | 2759 | 87.50% | 2.60% | 4.06% | 5.84% | NA |
| All Japonica | 1512 | 68.40% | 0.00% | 9.39% | 22.22% | NA |
| Aus | 269 | 85.90% | 0.00% | 9.67% | 4.46% | NA |
| Indica I | 595 | 88.10% | 5.00% | 6.55% | 0.34% | NA |
| Indica II | 465 | 74.00% | 3.00% | 9.25% | 13.76% | NA |
| Indica III | 913 | 93.20% | 0.00% | 1.53% | 5.26% | NA |
| Indica Intermediate | 786 | 88.50% | 3.40% | 2.04% | 5.98% | NA |
| Temperate Japonica | 767 | 90.90% | 0.00% | 2.74% | 6.39% | NA |
| Tropical Japonica | 504 | 34.90% | 0.00% | 19.44% | 45.63% | NA |
| Japonica Intermediate | 241 | 66.80% | 0.00% | 9.54% | 23.65% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 5.21% | 4.17% | NA |
| Intermediate | 90 | 82.20% | 2.20% | 4.44% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1211781305 | C -> DEL | LOC_Os12g20200.1 | N | frameshift_variant | Average:62.238; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg1211781305 | C -> T | LOC_Os12g20200.1 | synonymous_variant ; p.His212His; LOW | synonymous_codon | Average:62.238; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1211781305 | NA | 7.06E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211781305 | NA | 1.32E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211781305 | 9.18E-08 | NA | mr1141 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211781305 | 8.25E-09 | 4.64E-09 | mr1141 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211781305 | NA | 1.65E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211781305 | NA | 1.62E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211781305 | NA | 4.86E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1211781305 | NA | 7.00E-08 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |