Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211652112:

Variant ID: vg1211652112 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 11652112
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.08, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

AACCTGGTTCATCCTTGTATCCTTTTTACTTTTTATTCTAACTCTACCCTTGCTATCCTAGAGAAGTATTCCTGTCAAACTCTTCTCAACCATAGAGCAA[A/C]
CTCTTTTTGAGTTGTCTGCTCCTCGGGTCGAATTCTATGAGCCACCTCCTTCATCGGAGCACATTTATACAACTGGCTATGAAATTCGTCCCGAACTAAT

Reverse complement sequence

ATTAGTTCGGGACGAATTTCATAGCCAGTTGTATAAATGTGCTCCGATGAAGGAGGTGGCTCATAGAATTCGACCCGAGGAGCAGACAACTCAAAAAGAG[T/G]
TTGCTCTATGGTTGAGAAGAGTTTGACAGGAATACTTCTCTAGGATAGCAAGGGTAGAGTTAGAATAAAAAGTAAAAAGGATACAAGGATGAACCAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.70%	32.20%	13.65%	8.48%	NA
All Indica	2759	44.00%	35.30%	20.48%	0.22%	NA
All Japonica	1512	57.10%	15.30%	2.05%	25.46%	NA
Aus	269	7.40%	78.80%	13.75%	0.00%	NA
Indica I	595	40.20%	58.20%	1.68%	0.00%	NA
Indica II	465	47.70%	11.80%	40.22%	0.22%	NA
Indica III	913	47.30%	30.20%	22.34%	0.11%	NA
Indica Intermediate	786	40.70%	37.90%	20.87%	0.51%	NA
Temperate Japonica	767	87.50%	7.60%	1.04%	3.91%	NA
Tropical Japonica	504	21.00%	16.70%	3.17%	59.13%	NA
Japonica Intermediate	241	36.10%	37.30%	2.90%	23.65%	NA
VI/Aromatic	96	17.70%	70.80%	4.17%	7.29%	NA
Intermediate	90	51.10%	36.70%	8.89%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211652112	A -> C	LOC_Os12g20020.1	upstream_gene_variant ; 3047.0bp to feature; MODIFIER	silent_mutation	Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg1211652112	A -> C	LOC_Os12g20030.1	upstream_gene_variant ; 1158.0bp to feature; MODIFIER	silent_mutation	Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg1211652112	A -> C	LOC_Os12g20040.1	upstream_gene_variant ; 677.0bp to feature; MODIFIER	silent_mutation	Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg1211652112	A -> C	LOC_Os12g20030-LOC_Os12g20040	intergenic_region ; MODIFIER	silent_mutation	Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg1211652112	A -> DEL	N	N	silent_mutation	Average:26.484; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211652112	NA	5.05E-08	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211652112	2.55E-06	NA	mr1566_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211652112	NA	4.57E-06	mr1566_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211652112	NA	8.48E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211652112	NA	1.11E-13	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251