Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211581493:

Variant ID: vg1211581493 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 11581493
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAGATGAAGGTTTCTCCGAGGAGTAGGCTTCGTCCGTGCCGTCGAGGATGCCTGTGGAGTGGTGTTCCCGCTGCAGTTTTAGTCATGGCTTAGCTCCT[G/T]
TTGTCTTTCTTTTCTTCCGCTGCATTTTTGTAAGACTTTTATGATGTTTGTAAGACGTGGATCTGAATGTCAACATTGTCGTTTGTGTACCCCGGCTGGT

Reverse complement sequence

ACCAGCCGGGGTACACAAACGACAATGTTGACATTCAGATCCACGTCTTACAAACATCATAAAAGTCTTACAAAAATGCAGCGGAAGAAAAGAAAGACAA[C/A]
AGGAGCTAAGCCATGACTAAAACTGCAGCGGGAACACCACTCCACAGGCATCCTCGACGGCACGGACGAAGCCTACTCCTCGGAGAAACCTTCATCTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	5.90%	1.59%	0.00%	NA
All Indica	2759	99.60%	0.10%	0.22%	0.00%	NA
All Japonica	1512	77.60%	18.10%	4.37%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	0.40%	0.86%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.10%	0.25%	0.00%	NA
Temperate Japonica	767	97.30%	0.80%	1.96%	0.00%	NA
Tropical Japonica	504	40.30%	50.80%	8.93%	0.00%	NA
Japonica Intermediate	241	92.90%	4.60%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211581493	G -> T	LOC_Os12g19860.1	upstream_gene_variant ; 4939.0bp to feature; MODIFIER	silent_mutation	Average:60.81; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg1211581493	G -> T	LOC_Os12g19870.1	upstream_gene_variant ; 2022.0bp to feature; MODIFIER	silent_mutation	Average:60.81; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg1211581493	G -> T	LOC_Os12g19880.1	upstream_gene_variant ; 1381.0bp to feature; MODIFIER	silent_mutation	Average:60.81; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg1211581493	G -> T	LOC_Os12g19890.1	downstream_gene_variant ; 4162.0bp to feature; MODIFIER	silent_mutation	Average:60.81; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N
vg1211581493	G -> T	LOC_Os12g19870-LOC_Os12g19880	intergenic_region ; MODIFIER	silent_mutation	Average:60.81; most accessible tissue: Zhenshan97 flag leaf, score: 87.846	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1211581493	G	T	-0.01	-0.01	-0.01	-0.02	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211581493	NA	1.52E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	2.26E-07	mr1159	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	6.71E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	1.10E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	2.84E-07	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	8.09E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	2.13E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	6.59E-06	mr1427	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	6.95E-07	6.95E-07	mr1528	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	2.51E-08	mr1622	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	1.20E-07	mr1653	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	2.26E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211581493	NA	3.88E-07	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251