Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211120342:

Variant ID: vg1211120342 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 11120342
Reference Allele: C	Alternative Allele: T,CTTT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGAAGGCCGCCCACCCGCACCTCTTCGCCAGCTCTTCCGAATCTCGGGGTCGAGATTCCGTTTAAGGGGGGTAGGTTTGTCACGCCCAGAAGTTTCCC[C/T,CTTT]
CTTTTTCCTTGCTTTAAATATTTGTTAAATAAATCGTCCGAAGAAATTATCTTAATTAACCTAGAGCTAAATCCCTAGTTAATAAATGCAATTAATAATC

Reverse complement sequence

GATTATTAATTGCATTTATTAACTAGGGATTTAGCTCTAGGTTAATTAAGATAATTTCTTCGGACGATTTATTTAACAAATATTTAAAGCAAGGAAAAAG[G/A,AAAG]
GGGAAACTTCTGGGCGTGACAAACCTACCCCCCTTAAACGGAATCTCGACCCCGAGATTCGGAAGAGCTGGCGAAGAGGTGCGGGTGGGCGGCCTTCAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	0.60%	1.71%	4.17%	NA
All Indica	2759	99.40%	0.10%	0.04%	0.47%	NA
All Japonica	1512	81.60%	1.30%	5.16%	11.90%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	99.50%	0.00%	0.00%	0.50%	NA
Indica II	465	98.70%	0.00%	0.22%	1.08%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	99.40%	0.10%	0.00%	0.51%	NA
Temperate Japonica	767	89.60%	0.00%	1.69%	8.74%	NA
Tropical Japonica	504	70.60%	4.00%	9.92%	15.48%	NA
Japonica Intermediate	241	79.30%	0.00%	6.22%	14.52%	NA
VI/Aromatic	96	91.70%	5.20%	2.08%	1.04%	NA
Intermediate	90	97.80%	0.00%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211120342	C -> CTTT	LOC_Os12g19150.1	downstream_gene_variant ; 298.0bp to feature; MODIFIER	N	Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268	N	N	N	N
vg1211120342	C -> CTTT	LOC_Os12g19160.1	downstream_gene_variant ; 2745.0bp to feature; MODIFIER	N	Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268	N	N	N	N
vg1211120342	C -> CTTT	LOC_Os12g19150-LOC_Os12g19160	intergenic_region ; MODIFIER	N	Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268	N	N	N	N
vg1211120342	C -> DEL	N	N	silent_mutation	Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268	N	N	N	N
vg1211120342	C -> T	LOC_Os12g19150.1	downstream_gene_variant ; 297.0bp to feature; MODIFIER	silent_mutation	Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268	N	N	N	N
vg1211120342	C -> T	LOC_Os12g19160.1	downstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268	N	N	N	N
vg1211120342	C -> T	LOC_Os12g19150-LOC_Os12g19160	intergenic_region ; MODIFIER	silent_mutation	Average:14.637; most accessible tissue: Minghui63 young leaf, score: 21.268	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211120342	NA	1.47E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342	NA	7.83E-07	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342	NA	2.70E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342	5.42E-06	1.11E-09	mr1553_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342	NA	7.67E-07	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342	NA	9.12E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211120342	NA	1.83E-09	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251