Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210368322:

Variant ID: vg1210368322 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10368322
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

GCAACGACGCTATGATTGGGTCTTCAAATAAAGAACAAGAATCGCCTCACGCTCAGCTAGGAACATCCTCAGGTAACTCATCTTCTCAAGTGATGCCGAT[T/G]
TGAATAGCTCCAGCTTATTCGTCTAATATCTTGGAAATACATCAGGACCACCAGGCGATGACGAAGAAGAAATCCCTCGCATAAAGGCGGCTGACGACTC

Reverse complement sequence

GAGTCGTCAGCCGCCTTTATGCGAGGGATTTCTTCTTCGTCATCGCCTGGTGGTCCTGATGTATTTCCAAGATATTAGACGAATAAGCTGGAGCTATTCA[A/C]
ATCGGCATCACTTGAGAAGATGAGTTACCTGAGGATGTTCCTAGCTGAGCGTGAGGCGATTCTTGTTCTTTATTTGAAGACCCAATCATAGCGTCGTTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.80%	27.00%	13.86%	29.35%	NA
All Indica	2759	46.50%	5.90%	16.46%	31.06%	NA
All Japonica	1512	4.50%	69.30%	4.30%	21.89%	NA
Aus	269	8.90%	5.90%	43.87%	41.26%	NA
Indica I	595	21.50%	3.40%	17.98%	57.14%	NA
Indica II	465	34.40%	13.30%	15.27%	36.99%	NA
Indica III	913	71.30%	3.20%	14.90%	10.62%	NA
Indica Intermediate	786	43.90%	6.70%	17.81%	31.55%	NA
Temperate Japonica	767	0.50%	77.80%	3.13%	18.51%	NA
Tropical Japonica	504	11.70%	62.70%	5.36%	20.24%	NA
Japonica Intermediate	241	2.10%	56.00%	5.81%	36.10%	NA
VI/Aromatic	96	14.60%	10.40%	8.33%	66.67%	NA
Intermediate	90	21.10%	41.10%	11.11%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210368322	T -> DEL	N	N	silent_mutation	Average:35.931; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg1210368322	T -> G	LOC_Os12g18020.1	upstream_gene_variant ; 4589.0bp to feature; MODIFIER	silent_mutation	Average:35.931; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg1210368322	T -> G	LOC_Os12g18040.1	downstream_gene_variant ; 1513.0bp to feature; MODIFIER	silent_mutation	Average:35.931; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg1210368322	T -> G	LOC_Os12g18030.1	intron_variant ; MODIFIER	silent_mutation	Average:35.931; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210368322	NA	2.56E-06	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210368322	NA	3.69E-07	mr1129	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210368322	NA	2.51E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210368322	NA	9.05E-07	mr1164_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210368322	NA	1.39E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251