Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210359727:

Variant ID: vg1210359727 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10359727
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGGGTTAAGAACCGGGACTACTGATAAGCGCACTGAATATTATTTTCCATTACATATGTGTTTCTAAAATAGAAGATAATGCATTACAATTATTTAAA[G/A]
TACAAAGATTAATGATAATTACTTCGAAAAATTATTGTTGTCTGTAATAAATTAAGTGGATAAAACGTAATAAGCAAATATATGATTTGAAATTAATAAA

Reverse complement sequence

TTTATTAATTTCAAATCATATATTTGCTTATTACGTTTTATCCACTTAATTTATTACAGACAACAATAATTTTTCGAAGTAATTATCATTAATCTTTGTA[C/T]
TTTAAATAATTGTAATGCATTATCTTCTATTTTAGAAACACATATGTAATGGAAAATAATATTCAGTGCGCTTATCAGTAGTCCCGGTTCTTAACCCTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.10%	2.90%	16.06%	47.95%	NA
All Indica	2759	10.90%	5.00%	22.04%	62.09%	NA
All Japonica	1512	77.40%	0.10%	0.93%	21.63%	NA
Aus	269	11.20%	0.00%	36.43%	52.42%	NA
Indica I	595	6.40%	4.70%	14.29%	74.62%	NA
Indica II	465	17.60%	1.70%	14.19%	66.45%	NA
Indica III	913	10.70%	6.40%	31.43%	51.48%	NA
Indica Intermediate	786	10.60%	5.50%	21.63%	62.34%	NA
Temperate Japonica	767	90.10%	0.10%	0.78%	9.00%	NA
Tropical Japonica	504	63.30%	0.00%	1.59%	35.12%	NA
Japonica Intermediate	241	66.40%	0.00%	0.00%	33.61%	NA
VI/Aromatic	96	20.80%	1.00%	28.12%	50.00%	NA
Intermediate	90	45.60%	0.00%	13.33%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210359727	G -> DEL	N	N	silent_mutation	Average:18.312; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg1210359727	G -> A	LOC_Os12g18010.1	upstream_gene_variant ; 875.0bp to feature; MODIFIER	silent_mutation	Average:18.312; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg1210359727	G -> A	LOC_Os12g18020.1	downstream_gene_variant ; 723.0bp to feature; MODIFIER	silent_mutation	Average:18.312; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N
vg1210359727	G -> A	LOC_Os12g18010-LOC_Os12g18020	intergenic_region ; MODIFIER	silent_mutation	Average:18.312; most accessible tissue: Minghui63 flag leaf, score: 35.078	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210359727	1.73E-07	8.70E-11	mr1172_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210359727	2.18E-06	2.33E-07	mr1172_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251