Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209949245:

Variant ID: vg1209949245 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9949245
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTGACAGAATCAAACATTGATGCCTGCAATTTTTGTGGCTTTTGTCATTCCTTGCATGGTTGACACTCTTCCAGTCAGATGGTACCGTGGCTTTTCTG[T/A]
ATTTTGTGATGGTGAAAGCCCCAGTGGGAATGTGGGATGTTCAGTACTAGCATTGTGTGTAGTTTGTATTCATGCTACAAAATGCCTCTCAAGGTTCTAT

Reverse complement sequence

ATAGAACCTTGAGAGGCATTTTGTAGCATGAATACAAACTACACACAATGCTAGTACTGAACATCCCACATTCCCACTGGGGCTTTCACCATCACAAAAT[A/T]
CAGAAAAGCCACGGTACCATCTGACTGGAAGAGTGTCAACCATGCAAGGAATGACAAAAGCCACAAAAATTGCAGGCATCAATGTTTGATTCTGTCAGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.50%	13.90%	0.42%	57.15%	NA
All Indica	2759	6.30%	21.40%	0.69%	71.58%	NA
All Japonica	1512	73.70%	3.00%	0.00%	23.28%	NA
Aus	269	4.10%	1.50%	0.00%	94.42%	NA
Indica I	595	6.70%	22.90%	0.50%	69.92%	NA
Indica II	465	14.40%	15.50%	0.65%	69.46%	NA
Indica III	913	2.40%	24.40%	0.22%	72.95%	NA
Indica Intermediate	786	5.70%	20.40%	1.40%	72.52%	NA
Temperate Japonica	767	82.50%	2.90%	0.00%	14.60%	NA
Tropical Japonica	504	67.70%	0.20%	0.00%	32.14%	NA
Japonica Intermediate	241	58.10%	9.50%	0.00%	32.37%	NA
VI/Aromatic	96	9.40%	9.40%	0.00%	81.25%	NA
Intermediate	90	43.30%	8.90%	1.11%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209949245	T -> DEL	N	N	silent_mutation	Average:42.405; most accessible tissue: Callus, score: 76.892	N	N	N	N
vg1209949245	T -> A	LOC_Os12g17360.1	downstream_gene_variant ; 4602.0bp to feature; MODIFIER	silent_mutation	Average:42.405; most accessible tissue: Callus, score: 76.892	N	N	N	N
vg1209949245	T -> A	LOC_Os12g17370.1	downstream_gene_variant ; 488.0bp to feature; MODIFIER	silent_mutation	Average:42.405; most accessible tissue: Callus, score: 76.892	N	N	N	N
vg1209949245	T -> A	LOC_Os12g17370-LOC_Os12g17390	intergenic_region ; MODIFIER	silent_mutation	Average:42.405; most accessible tissue: Callus, score: 76.892	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209949245	NA	3.85E-06	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	1.21E-06	2.55E-07	mr1337	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	6.73E-06	NA	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	1.68E-06	2.85E-07	mr1312_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	2.27E-06	2.27E-06	mr1312_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	6.51E-06	1.80E-07	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	4.23E-06	4.22E-06	mr1651_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	NA	2.13E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	6.54E-06	3.14E-06	mr1832_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	4.10E-06	1.18E-06	mr1833_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209949245	6.18E-06	6.19E-06	mr1847_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251