Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209676037:

Variant ID: vg1209676037 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9676037
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, G: 0.11, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTGTAAAATTCGTAACTAATTCATATGAACTCGGAATGAGGCCGTTCAAGTCTCTAAATTCATCTAAAATCATGATCTACATGTTTTTTTTTTACTT[T/G]
TTATGTATTGTTCATTTGGTTTTTATTAGTCCTTTTTATTCGTTTTGCGTGTTAGCTTGTCGTTTCTGTCGTTGCGAAGGTCCGTGAGTGCGTCAGAAGT

Reverse complement sequence

ACTTCTGACGCACTCACGGACCTTCGCAACGACAGAAACGACAAGCTAACACGCAAAACGAATAAAAAGGACTAATAAAAACCAAATGAACAATACATAA[A/C]
AAGTAAAAAAAAAACATGTAGATCATGATTTTAGATGAATTTAGAGACTTGAACGGCCTCATTCCGAGTTCATATGAATTAGTTACGAATTTTACAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	24.90%	0.72%	24.35%	NA
All Indica	2759	38.20%	23.20%	1.05%	37.59%	NA
All Japonica	1512	80.00%	16.70%	0.33%	2.91%	NA
Aus	269	9.30%	74.70%	0.00%	15.99%	NA
Indica I	595	37.30%	46.10%	0.50%	16.13%	NA
Indica II	465	62.20%	8.00%	0.43%	29.46%	NA
Indica III	913	21.80%	15.90%	1.75%	60.57%	NA
Indica Intermediate	786	43.80%	23.30%	1.02%	31.93%	NA
Temperate Japonica	767	87.70%	6.80%	0.52%	4.95%	NA
Tropical Japonica	504	74.60%	24.20%	0.00%	1.19%	NA
Japonica Intermediate	241	66.80%	32.80%	0.41%	0.00%	NA
VI/Aromatic	96	20.80%	58.30%	0.00%	20.83%	NA
Intermediate	90	60.00%	32.20%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209676037	T -> DEL	N	N	silent_mutation	Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1209676037	T -> G	LOC_Os12g16870.1	upstream_gene_variant ; 422.0bp to feature; MODIFIER	silent_mutation	Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1209676037	T -> G	LOC_Os12g16860.1	downstream_gene_variant ; 4004.0bp to feature; MODIFIER	silent_mutation	Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1209676037	T -> G	LOC_Os12g16870-LOC_Os12g16880	intergenic_region ; MODIFIER	silent_mutation	Average:41.401; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209676037	NA	4.26E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037	NA	3.65E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037	NA	9.70E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037	NA	2.05E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037	NA	5.65E-07	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037	8.51E-07	8.48E-07	mr1207_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037	NA	3.38E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209676037	NA	1.66E-07	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251