Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209153210:

Variant ID: vg1209153210 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9153210
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, C: 0.30, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTTCTTCTTTCATCTATCTCCAAGATACGGATTAGTTGATCGCACCAGCTCGACCTTCTCCTCCTCGTGCGTTCACCTCGCTGTACTCCCACGCCGAT[A/C,T]
AGCACCGCAAACTAGCGGCGCCTCTACCGGTATCCACACGTACAGGGACGGAACGCCACGCGCAGATGTGCTAGCACCCGCGCGCAGCTAGGGTTTTGCT

Reverse complement sequence

AGCAAAACCCTAGCTGCGCGCGGGTGCTAGCACATCTGCGCGTGGCGTTCCGTCCCTGTACGTGTGGATACCGGTAGAGGCGCCGCTAGTTTGCGGTGCT[T/G,A]
ATCGGCGTGGGAGTACAGCGAGGTGAACGCACGAGGAGGAGAAGGTCGAGCTGGTGCGATCAACTAATCCGTATCTTGGAGATAGATGAAAGAAGAACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 33.70% 9.73% 0.32% NA
All Indica  2759 86.00% 2.90% 10.51% 0.54% NA
All Japonica  1512 5.20% 94.40% 0.40% 0.00% NA
Aus  269 51.30% 3.70% 44.98% 0.00% NA
Indica I  595 82.70% 1.80% 14.79% 0.67% NA
Indica II  465 88.20% 3.90% 7.53% 0.43% NA
Indica III  913 88.10% 2.00% 9.97% 0.00% NA
Indica Intermediate  786 84.90% 4.30% 9.67% 1.15% NA
Temperate Japonica  767 6.80% 92.80% 0.39% 0.00% NA
Tropical Japonica  504 4.00% 95.60% 0.40% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 22.90% 32.29% 0.00% NA
Intermediate  90 31.10% 55.60% 13.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209153210 A -> C LOC_Os12g16060.1 downstream_gene_variant ; 1179.0bp to feature; MODIFIER silent_mutation Average:21.458; most accessible tissue: Callus, score: 38.065 N N N N
vg1209153210 A -> C LOC_Os12g16050-LOC_Os12g16060 intergenic_region ; MODIFIER silent_mutation Average:21.458; most accessible tissue: Callus, score: 38.065 N N N N
vg1209153210 A -> DEL N N silent_mutation Average:21.458; most accessible tissue: Callus, score: 38.065 N N N N
vg1209153210 A -> T LOC_Os12g16060.1 downstream_gene_variant ; 1179.0bp to feature; MODIFIER N Average:21.458; most accessible tissue: Callus, score: 38.065 N N N N
vg1209153210 A -> T LOC_Os12g16050-LOC_Os12g16060 intergenic_region ; MODIFIER N Average:21.458; most accessible tissue: Callus, score: 38.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209153210 NA 4.38E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.41E-34 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.75E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.81E-33 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.73E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.18E-69 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 3.98E-26 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.64E-81 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.21E-78 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 3.08E-57 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.78E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 8.77E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 5.40E-33 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.67E-77 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.50E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 5.75E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 7.72E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 4.08E-20 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.58E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.12E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.79E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 6.14E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.27E-23 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 4.25E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 6.62E-60 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.25E-35 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 9.26E-50 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 3.17E-63 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.08E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.34E-48 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 3.67E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 6.74E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.32E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 4.56E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.93E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.57E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 5.47E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 8.73E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 5.35E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.05E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.29E-22 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.44E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 3.50E-74 mr1889_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 3.56E-73 mr1896_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 5.46E-103 mr1907_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.74E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 2.93E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209153210 NA 1.17E-94 mr1934_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251