Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209080302:

Variant ID: vg1209080302 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9080302
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTCTTCCCCCTTCTCTTCCTTATCTTCTCCCCTTCCCCTCTCCTCCCCTCCTCGGCTTCTACTCGAGGCGGGCGGGTGGGGCGGGCCCGATGGCAA[T/C]
GGGTGGCAGCGTCGACAGAGCCTCCCCCACCTTCTATTCCCCTCTCCTCGGCTTCTACTAGCAGTGGGTGGGCAGGGTGGGCCCGATGGCGGCGGGCAAC

Reverse complement sequence

GTTGCCCGCCGCCATCGGGCCCACCCTGCCCACCCACTGCTAGTAGAAGCCGAGGAGAGGGGAATAGAAGGTGGGGGAGGCTCTGTCGACGCTGCCACCC[A/G]
TTGCCATCGGGCCCGCCCCACCCGCCCGCCTCGAGTAGAAGCCGAGGAGGGGAGGAGAGGGGAAGGGGAGAAGATAAGGAAGAGAAGGGGGAAGAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.30% 0.21% 0.00% NA
All Indica  2759 88.40% 11.30% 0.33% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 83.00% 16.80% 0.17% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 89.90% 9.70% 0.33% 0.00% NA
Indica Intermediate  786 87.90% 11.50% 0.64% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209080302 T -> C LOC_Os12g15930.1 upstream_gene_variant ; 3143.0bp to feature; MODIFIER silent_mutation Average:71.724; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N
vg1209080302 T -> C LOC_Os12g15920.1 downstream_gene_variant ; 3185.0bp to feature; MODIFIER silent_mutation Average:71.724; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N
vg1209080302 T -> C LOC_Os12g15920-LOC_Os12g15930 intergenic_region ; MODIFIER silent_mutation Average:71.724; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209080302 T C -0.03 -0.03 -0.03 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209080302 1.36E-06 NA mr1047_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209080302 4.71E-06 NA mr1189_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209080302 1.68E-06 NA mr1477_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209080302 5.16E-07 NA mr1722_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251